EMAIL THIS PAGE TO A FRIEND

ZNF136

zinc finger protein 136

Synonyms: pHZ-20
Species: Human ZNF136(7695)
UniProtKB ID: P52737
Gene ID:
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003437 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003437 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335658 predicted 720
2 SASI_Hs01_00246647 predicted 669
3 SASI_Hs02_00335659 predicted 510
4 SASI_Hs01_00246649 predicted 512
5 SASI_Hs01_00246650 predicted 250
6 SASI_Hs01_00246651 predicted 445
7 SASI_Hs01_00246653 predicted 648
8 SASI_Hs01_00246654 predicted 1681
9 SASI_Hs01_00246655 predicted 358
10 SASI_Hs02_00335660 predicted 450
11 SASI_Hs01_00246646 predicted 1539
12 SASI_Hs01_00246648 predicted 1374
13 SASI_Hs01_00246652 predicted 1104
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003437
ZNF136 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 136
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003437.2-670s21c1
Sequence:CCGGCAGTGGATATACACCATATAACTCGAGTTATATGGTGTATATCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003437.2-563s21c1
Sequence:CCGGTTTCGAACACATGAGATAATTCTCGAGAATTATCTCATGTGTTCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003437.2-2287s21c1
Sequence:CCGGCTGTGGCTTTGTGGGTTAAAGCTCGAGCTTTAACCCACAAAGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003437.2-1234s21c1
Sequence:CCGGTATGCGAAGACACATGATAAACTCGAGTTTATCATGTGTCTTCGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003437.2-1681s21c1
Sequence:CCGGTGAAGATGGACCACCTTATAACTCGAGTTATAAGGTGGTCCATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003437.2-1680s1c1
Sequence:CCGGCTGAAGATGGACCACCTTATACTCGAGTATAAGGTGGTCCATCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003437.2-879s1c1
Sequence:CCGGCCTTTCATTCTCTGAGTTCATCTCGAGATGAACTCAGAGAATGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003437.2-722s1c1
Sequence:CCGGCCCAGTAGATTTCGAACACATCTCGAGATGTGTTCGAAATCTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003437.2-2173s1c1
Sequence:CCGGCCCACATGCTTTCAACAACATCTCGAGATGTTGTTGAAAGCATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003437
ZNF136 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 136
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003437.2-670s21c1
Sequence:CCGGCAGTGGATATACACCATATAACTCGAGTTATATGGTGTATATCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003437.2-563s21c1
Sequence:CCGGTTTCGAACACATGAGATAATTCTCGAGAATTATCTCATGTGTTCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003437.2-2287s21c1
Sequence:CCGGCTGTGGCTTTGTGGGTTAAAGCTCGAGCTTTAACCCACAAAGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003437.2-1234s21c1
Sequence:CCGGTATGCGAAGACACATGATAAACTCGAGTTTATCATGTGTCTTCGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003437.2-1681s21c1
Sequence:CCGGTGAAGATGGACCACCTTATAACTCGAGTTATAAGGTGGTCCATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003437.2-1680s1c1
Sequence:CCGGCTGAAGATGGACCACCTTATACTCGAGTATAAGGTGGTCCATCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003437.2-879s1c1
Sequence:CCGGCCTTTCATTCTCTGAGTTCATCTCGAGATGAACTCAGAGAATGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003437.2-722s1c1
Sequence:CCGGCCCAGTAGATTTCGAACACATCTCGAGATGTGTTCGAAATCTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003437.2-2173s1c1
Sequence:CCGGCCCACATGCTTTCAACAACATCTCGAGATGTTGTTGAAAGCATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003437
ZNF136 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 136
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003437.2-670s21c1
Sequence:CCGGCAGTGGATATACACCATATAACTCGAGTTATATGGTGTATATCCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003437.2-563s21c1
Sequence:CCGGTTTCGAACACATGAGATAATTCTCGAGAATTATCTCATGTGTTCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232175    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003437.2-2287s21c1
Sequence:CCGGCTGTGGCTTTGTGGGTTAAAGCTCGAGCTTTAACCCACAAAGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003437.2-1234s21c1
Sequence:CCGGTATGCGAAGACACATGATAAACTCGAGTTTATCATGTGTCTTCGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003437.2-1681s21c1
Sequence:CCGGTGAAGATGGACCACCTTATAACTCGAGTTATAAGGTGGTCCATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003437.2-1680s1c1
Sequence:CCGGCTGAAGATGGACCACCTTATACTCGAGTATAAGGTGGTCCATCTTCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003437.2-879s1c1
Sequence:CCGGCCTTTCATTCTCTGAGTTCATCTCGAGATGAACTCAGAGAATGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003437.2-722s1c1
Sequence:CCGGCCCAGTAGATTTCGAACACATCTCGAGATGTGTTCGAAATCTACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003437.2-2173s1c1
Sequence:CCGGCCCACATGCTTTCAACAACATCTCGAGATGTTGTTGAAAGCATGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks