EMAIL THIS PAGE TO A FRIEND

ZNF137P

zinc finger protein 137, pseudogene

Synonyms: ZNF137 pHZ-30
Species: Human ZNF137P(7696)
UniProtKB ID: P52743, Q2TBC7
Gene ID:
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003438 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003438 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003438 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003438 Rosetta Predictions human pricing
NR_023311 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003438 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113132 predicted 739
2 SASI_Hs01_00113133 predicted 167
3 SASI_Hs01_00113134 predicted 793
4 SASI_Hs01_00113135 predicted 172
5 SASI_Hs01_00113136 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381592 predicted 736
2 SASI_Hs02_00381593 predicted 9
3 SASI_Hs02_00381594 predicted 1165
4 SASI_Hs02_00381595 predicted 162
5 SASI_Hs02_00381596 predicted 787
6 SASI_Hs02_00381597 predicted 168
7 SASI_Hs02_00381598 predicted 1220
8 SASI_Hs02_00381599 predicted 733
9 SASI_Hs02_00381600 predicted 1243
10 SASI_Hs02_00381601 predicted 1200
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003438
ZNF137P MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 137, pseudogene
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003438.1-1868s1c1
Sequence:CCGGCGGATCATTGTCCCTTCTTATCTCGAGATAAGAAGGGACAATGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003438.1-497s1c1
Sequence:CCGGGCGAACTCATACTGGAGAGAACTCGAGTTCTCTCCAGTATGAGTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003438.1-474s1c1
Sequence:CCGGCGATCATATCTTGCAGTTTATCTCGAGATAAACTGCAAGATATGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003438.1-197s1c1
Sequence:CCGGCATACTGTCTAAGGTTTCTAACTCGAGTTAGAAACCTTAGACAGTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003438.1-188s1c1
Sequence:CCGGCATAGACTTCATACTGTCTAACTCGAGTTAGACAGTATGAAGTCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003438
ZNF137P MISSION shRNA shRNA Plasmid DNA
zinc finger protein 137, pseudogene
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003438.1-1868s1c1
Sequence:CCGGCGGATCATTGTCCCTTCTTATCTCGAGATAAGAAGGGACAATGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003438.1-497s1c1
Sequence:CCGGGCGAACTCATACTGGAGAGAACTCGAGTTCTCTCCAGTATGAGTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003438.1-474s1c1
Sequence:CCGGCGATCATATCTTGCAGTTTATCTCGAGATAAACTGCAAGATATGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003438.1-197s1c1
Sequence:CCGGCATACTGTCTAAGGTTTCTAACTCGAGTTAGAAACCTTAGACAGTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003438.1-188s1c1
Sequence:CCGGCATAGACTTCATACTGTCTAACTCGAGTTAGACAGTATGAAGTCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003438
ZNF137P MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 137, pseudogene
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003438.1-1868s1c1
Sequence:CCGGCGGATCATTGTCCCTTCTTATCTCGAGATAAGAAGGGACAATGATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003438.1-497s1c1
Sequence:CCGGGCGAACTCATACTGGAGAGAACTCGAGTTCTCTCCAGTATGAGTTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003438.1-474s1c1
Sequence:CCGGCGATCATATCTTGCAGTTTATCTCGAGATAAACTGCAAGATATGATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003438.1-197s1c1
Sequence:CCGGCATACTGTCTAAGGTTTCTAACTCGAGTTAGAAACCTTAGACAGTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003438.1-188s1c1
Sequence:CCGGCATAGACTTCATACTGTCTAACTCGAGTTAGACAGTATGAAGTCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks