EMAIL THIS PAGE TO A FRIEND

ZNF140

zinc finger protein 140

Synonyms: pHZ-39
UniProtKB ID: P52738, D3DXJ3, Q8IV75
Gene ID:
domestic guinea pig(101787285) zinc finger protein 140
naked mole-rat(101696953) zinc finger protein 140
cow(785125) zinc finger protein 140
dog(100855854) zinc finger protein 140
domestic cat(101095199) zinc finger protein 140
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003440 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003440 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335663 predicted 755
2 SASI_Hs01_00102276 predicted 1776
3 SASI_Hs01_00102278 predicted 1684
4 SASI_Hs01_00102280 predicted 820
5 SASI_Hs01_00102281 predicted 1256
6 SASI_Hs02_00335664 predicted 1459
7 SASI_Hs01_00102282 predicted 1530
8 SASI_Hs01_00102284 predicted 751
9 SASI_Hs02_00335665 predicted 1524
10 SASI_Hs02_00335666 predicted 1422
11 SASI_Hs01_00102275 predicted 911
12 SASI_Hs01_00102277 predicted 1034
13 SASI_Hs01_00102279 predicted 904
14 SASI_Hs01_00102283 predicted 1289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003440
ZNF140 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 140
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003440.2-2532s1c1
Sequence:CCGGGCCTTCATTTACAATGCAATACTCGAGTATTGCATTGTAAATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003440.2-1826s1c1
Sequence:CCGGGCGTGTGCTGAATGTGATAAACTCGAGTTTATCACATTCAGCACACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003440.2-1684s1c1
Sequence:CCGGCCGTTGTCACTCATTCCTTATCTCGAGATAAGGAATGAGTGACAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003440.2-966s1c1
Sequence:CCGGCCCAGTATTTGATCATGGAAACTCGAGTTTCCATGATCAAATACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003440.2-1443s1c1
Sequence:CCGGCCAACCTCACTCGACATCAAACTCGAGTTTGATGTCGAGTGAGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003440.2-909s21c1
Sequence:CCGGAGTCAAGTGGTGAGATCAAAGCTCGAGCTTTGATCTCACCACTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003440.2-1105s21c1
Sequence:CCGGAGAAGCCCTGGCTCAACATATCTCGAGATATGTTGAGCCAGGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003440
ZNF140 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 140
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003440.2-2532s1c1
Sequence:CCGGGCCTTCATTTACAATGCAATACTCGAGTATTGCATTGTAAATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003440.2-1826s1c1
Sequence:CCGGGCGTGTGCTGAATGTGATAAACTCGAGTTTATCACATTCAGCACACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003440.2-1684s1c1
Sequence:CCGGCCGTTGTCACTCATTCCTTATCTCGAGATAAGGAATGAGTGACAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003440.2-966s1c1
Sequence:CCGGCCCAGTATTTGATCATGGAAACTCGAGTTTCCATGATCAAATACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003440.2-1443s1c1
Sequence:CCGGCCAACCTCACTCGACATCAAACTCGAGTTTGATGTCGAGTGAGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003440.2-909s21c1
Sequence:CCGGAGTCAAGTGGTGAGATCAAAGCTCGAGCTTTGATCTCACCACTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003440.2-1105s21c1
Sequence:CCGGAGAAGCCCTGGCTCAACATATCTCGAGATATGTTGAGCCAGGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003440
ZNF140 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 140
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003440.2-2532s1c1
Sequence:CCGGGCCTTCATTTACAATGCAATACTCGAGTATTGCATTGTAAATGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003440.2-1826s1c1
Sequence:CCGGGCGTGTGCTGAATGTGATAAACTCGAGTTTATCACATTCAGCACACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003440.2-1684s1c1
Sequence:CCGGCCGTTGTCACTCATTCCTTATCTCGAGATAAGGAATGAGTGACAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003440.2-966s1c1
Sequence:CCGGCCCAGTATTTGATCATGGAAACTCGAGTTTCCATGATCAAATACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003440.2-1443s1c1
Sequence:CCGGCCAACCTCACTCGACATCAAACTCGAGTTTGATGTCGAGTGAGGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003440.2-909s21c1
Sequence:CCGGAGTCAAGTGGTGAGATCAAAGCTCGAGCTTTGATCTCACCACTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429933    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003440.2-1105s21c1
Sequence:CCGGAGAAGCCCTGGCTCAACATATCTCGAGATATGTTGAGCCAGGGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks