EMAIL THIS PAGE TO A FRIEND

ZNF141

zinc finger protein 141

Synonyms: D4S90 PAPA6 pHZ-44
Species: Human ZNF141(7700)
UniProtKB ID: Q15928, Q6DK07
Gene ID:
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003441 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122071 MISSION® esiRNA esiRNA human ZNF141 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003441 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060125 predicted 613
2 SASI_Hs01_00060126 predicted 1390
3 SASI_Hs01_00060127 predicted 613
4 SASI_Hs01_00060128 predicted 801
5 SASI_Hs02_00335667 predicted 690
6 SASI_Hs01_00060129 predicted 1059
7 SASI_Hs01_00060133 predicted 808
8 SASI_Hs01_00060130 predicted 1550
9 SASI_Hs02_00335668 predicted 1555
10 SASI_Hs01_00060124 predicted 1625
11 SASI_Hs01_00060131 predicted 1633
12 SASI_Hs01_00060132 predicted 1632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003441
ZNF141 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 141
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003441.2-733s21c1
Sequence:CCGGCCTAACTCAACATAAGGTAATCTCGAGATTACCTTATGTTGAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003441.2-1316s21c1
Sequence:CCGGAGGGTCCTGAATGAACATAAACTCGAGTTTATGTTCATTCAGGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003441.2-896s21c1
Sequence:CCGGTCACACTTTGCTAAGCATAAACTCGAGTTTATGCTTAGCAAAGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003441.1-1884s1c1
Sequence:CCGGCCGGTGAATAAACATAAGAAACTCGAGTTTCTTATGTTTATTCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003441.1-1464s1c1
Sequence:CCGGGCTCCTGAGTCAACATAAGAACTCGAGTTCTTATGTTGACTCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003441.1-1381s1c1
Sequence:CCGGGATCGGAGTCAACATAAGAAACTCGAGTTTCTTATGTTGACTCCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003441.1-378s1c1
Sequence:CCGGCCCAGCTATGTGTTCTCATTTCTCGAGAAATGAGAACACATAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003441.1-1540s1c1
Sequence:CCGGCGGTTCTCACACCTGAATAAACTCGAGTTTATTCAGGTGTGAGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003441
ZNF141 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 141
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003441.2-733s21c1
Sequence:CCGGCCTAACTCAACATAAGGTAATCTCGAGATTACCTTATGTTGAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003441.2-1316s21c1
Sequence:CCGGAGGGTCCTGAATGAACATAAACTCGAGTTTATGTTCATTCAGGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003441.2-896s21c1
Sequence:CCGGTCACACTTTGCTAAGCATAAACTCGAGTTTATGCTTAGCAAAGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003441.1-1884s1c1
Sequence:CCGGCCGGTGAATAAACATAAGAAACTCGAGTTTCTTATGTTTATTCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003441.1-1464s1c1
Sequence:CCGGGCTCCTGAGTCAACATAAGAACTCGAGTTCTTATGTTGACTCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003441.1-1381s1c1
Sequence:CCGGGATCGGAGTCAACATAAGAAACTCGAGTTTCTTATGTTGACTCCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003441.1-378s1c1
Sequence:CCGGCCCAGCTATGTGTTCTCATTTCTCGAGAAATGAGAACACATAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003441.1-1540s1c1
Sequence:CCGGCGGTTCTCACACCTGAATAAACTCGAGTTTATTCAGGTGTGAGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003441
ZNF141 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 141
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003441.2-733s21c1
Sequence:CCGGCCTAACTCAACATAAGGTAATCTCGAGATTACCTTATGTTGAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003441.2-1316s21c1
Sequence:CCGGAGGGTCCTGAATGAACATAAACTCGAGTTTATGTTCATTCAGGACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003441.2-896s21c1
Sequence:CCGGTCACACTTTGCTAAGCATAAACTCGAGTTTATGCTTAGCAAAGTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012928    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003441.1-1884s1c1
Sequence:CCGGCCGGTGAATAAACATAAGAAACTCGAGTTTCTTATGTTTATTCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003441.1-1464s1c1
Sequence:CCGGGCTCCTGAGTCAACATAAGAACTCGAGTTCTTATGTTGACTCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003441.1-1381s1c1
Sequence:CCGGGATCGGAGTCAACATAAGAAACTCGAGTTTCTTATGTTGACTCCGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003441.1-378s1c1
Sequence:CCGGCCCAGCTATGTGTTCTCATTTCTCGAGAAATGAGAACACATAGCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003441.1-1540s1c1
Sequence:CCGGCGGTTCTCACACCTGAATAAACTCGAGTTTATTCAGGTGTGAGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks