EMAIL THIS PAGE TO A FRIEND

ZNF142

zinc finger protein 142

Synonyms: pHZ-49
UniProtKB ID: P52746, Q92510
Gene ID:
Human(7701) Summary: The protein encoded by this gene belongs to the Kruppel family of C2H2-type zinc finger proteins. It contains 31 C2H2-type zinc fingers and may be involved in transcriptional regulation. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2013]
Zebrafish(561536) zinc finger protein 142
Horse(100055767) zinc finger protein 142
domestic cat(101098885) zinc finger protein 142
dog(488524) zinc finger protein 142
chicken(424213) zinc finger protein 142
cow(511573) zinc finger protein 142
sheep(101111263) zinc finger protein 142
naked mole-rat(101702729) zinc finger protein 142
domestic guinea pig(100714452) zinc finger protein 142
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA049594 Anti-ZNF142 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2106439 Anti-ZNF142 antibody produced in rabbit affinity isolated antibody human, guinea pig, horse, rabbit
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_376172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_376172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_376172 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001105537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001105537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001105537 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU032321 MISSION® esiRNA esiRNA human ZNF142 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001105537 Rosetta Predictions human pricing
NM_005081 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324261 predicted 4779
2 SASI_Hs02_00324262 predicted 1229
3 SASI_Hs02_00324263 predicted 2647
4 SASI_Hs02_00324264 predicted 3700
5 SASI_Hs02_00324265 predicted 4948
6 SASI_Hs02_00324266 predicted 2754
7 SASI_Hs02_00324267 predicted 1800
8 SASI_Hs02_00324268 predicted 2115
9 SASI_Hs02_00324269 predicted 913
10 SASI_Hs02_00324270 predicted 3093
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105197 predicted 5091
2 SASI_Hs01_00105198 predicted 1538
3 SASI_Hs01_00105199 predicted 2952
4 SASI_Hs01_00105200 predicted 4017
5 SASI_Hs01_00105201 predicted 5262
6 SASI_Hs01_00105202 predicted 3065
7 SASI_Hs01_00105203 predicted 2109
8 SASI_Hs01_00105204 predicted 2422
9 SASI_Hs01_00105205 predicted 1344
10 SASI_Hs02_00338927 predicted 3397
11 SASI_Hs01_00105206 predicted 1885
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_376172
VALIDATED
ZNF142 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 142
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:XM_376172.1-1224s1c1
Sequence:CCGGCCAGAAGTTCTTCACCAGTAACTCGAGTTACTGGTGAAGAACTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376172.1-5513s1c1
Sequence:CCGGGCAACTACAAGGCCAAGCAAACTCGAGTTTGCTTGGCCTTGTAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376172.1-3421s1c1
Sequence:CCGGGCATCACAAGAAGCAGAGCTACTCGAGTAGCTCTGCTTCTTGTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376172.1-1896s1c1
Sequence:CCGGGCTTCTACATACGGGTGAGAACTCGAGTTCTCACCCGTATGTAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:XM_376172.1-1986s1c1
Sequence:CCGGCCACTCCAACACCAAGGATTACTCGAGTAATCCTTGGTGTTGGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_376172
VALIDATED
ZNF142 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 142
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:XM_376172.1-1224s1c1
Sequence:CCGGCCAGAAGTTCTTCACCAGTAACTCGAGTTACTGGTGAAGAACTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376172.1-5513s1c1
Sequence:CCGGGCAACTACAAGGCCAAGCAAACTCGAGTTTGCTTGGCCTTGTAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376172.1-3421s1c1
Sequence:CCGGGCATCACAAGAAGCAGAGCTACTCGAGTAGCTCTGCTTCTTGTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376172.1-1896s1c1
Sequence:CCGGGCTTCTACATACGGGTGAGAACTCGAGTTCTCACCCGTATGTAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:XM_376172.1-1986s1c1
Sequence:CCGGCCACTCCAACACCAAGGATTACTCGAGTAATCCTTGGTGTTGGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_376172
VALIDATED
ZNF142 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 142
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018249    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:XM_376172.1-1224s1c1
Sequence:CCGGCCAGAAGTTCTTCACCAGTAACTCGAGTTACTGGTGAAGAACTTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376172.1-5513s1c1
Sequence:CCGGGCAACTACAAGGCCAAGCAAACTCGAGTTTGCTTGGCCTTGTAGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376172.1-3421s1c1
Sequence:CCGGGCATCACAAGAAGCAGAGCTACTCGAGTAGCTCTGCTTCTTGTGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_376172.1-1896s1c1
Sequence:CCGGGCTTCTACATACGGGTGAGAACTCGAGTTCTCACCCGTATGTAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018248    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:XM_376172.1-1986s1c1
Sequence:CCGGCCACTCCAACACCAAGGATTACTCGAGTAATCCTTGGTGTTGGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001105537
ZNF142 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 142
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105537.1-1330s21c1
Sequence:CCGGCGACCGCAAGGCCTTCATTAACTCGAGTTAATGAAGGCCTTGCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105537.1-5683s21c1
Sequence:CCGGCATGGACTATAACGTTGATTTCTCGAGAAATCAACGTTATAGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105537.1-2652s21c1
Sequence:GTACCGGTATCTAGCTTTGAAGGTATTGCTCGAGCAATACCTTCAAAGCTAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105537.1-2192s21c1
Sequence:GTACCGGACCACACTCTTGTTCCATAAACTCGAGTTTATGGAACAAGAGTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105537.1-4464s21c1
Sequence:CCGGTACGAGGACACACCCGTAAACCTCGAGGTTTACGGGTGTGTCCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001105537
ZNF142 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 142
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105537.1-1330s21c1
Sequence:CCGGCGACCGCAAGGCCTTCATTAACTCGAGTTAATGAAGGCCTTGCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105537.1-5683s21c1
Sequence:CCGGCATGGACTATAACGTTGATTTCTCGAGAAATCAACGTTATAGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105537.1-2652s21c1
Sequence:GTACCGGTATCTAGCTTTGAAGGTATTGCTCGAGCAATACCTTCAAAGCTAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105537.1-2192s21c1
Sequence:GTACCGGACCACACTCTTGTTCCATAAACTCGAGTTTATGGAACAAGAGTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105537.1-4464s21c1
Sequence:CCGGTACGAGGACACACCCGTAAACCTCGAGGTTTACGGGTGTGTCCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001105537
ZNF142 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 142
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105537.1-1330s21c1
Sequence:CCGGCGACCGCAAGGCCTTCATTAACTCGAGTTAATGAAGGCCTTGCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230869    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001105537.1-5683s21c1
Sequence:CCGGCATGGACTATAACGTTGATTTCTCGAGAAATCAACGTTATAGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105537.1-2652s21c1
Sequence:GTACCGGTATCTAGCTTTGAAGGTATTGCTCGAGCAATACCTTCAAAGCTAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105537.1-2192s21c1
Sequence:GTACCGGACCACACTCTTGTTCCATAAACTCGAGTTTATGGAACAAGAGTGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001105537.1-4464s21c1
Sequence:CCGGTACGAGGACACACCCGTAAACCTCGAGGTTTACGGGTGTGTCCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks