EMAIL THIS PAGE TO A FRIEND

ZNF143

zinc finger protein 143

Synonyms: SBF STAF pHZ-1
UniProtKB ID: P52747, A8K518, B4DLY5, O75559, Q8WUK9
Gene ID:
domestic guinea pig(100732087) zinc finger protein 143
naked mole-rat(101703267) zinc finger protein 143
Domestic Rabbit(100345473) zinc finger protein 143
cow(533243) zinc finger protein 143
sheep(101104778) zinc finger protein 143
chicken(428845) zinc finger protein 143
domestic cat(101086176) zinc finger protein 143
Horse(100055723) zinc finger protein 143
dog(485384) zinc finger protein 143
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003442 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022141 MISSION® esiRNA esiRNA human ZNF143 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003442 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191456 predicted 774
2 SASI_Hs01_00191457 predicted 1001
3 SASI_Hs01_00191458 predicted 1267
4 SASI_Hs01_00191459 predicted 1809
5 SASI_Hs01_00191460 predicted 1593
6 SASI_Hs01_00191461 predicted 531
7 SASI_Hs01_00191462 predicted 1176
8 SASI_Hs01_00191464 predicted 329
9 SASI_Hs02_00335669 predicted 1933
10 SASI_Hs01_00191465 predicted 1515
11 SASI_Hs01_00191463 predicted 1091
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003442
ZNF143 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 143
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003442.5-2256s21c1
Sequence:CCGGATTAGGGCAATACAGTAAATTCTCGAGAATTTACTGTATTGCCCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003442.5-1007s21c1
Sequence:CCGGATATCGGTGTTCGGAAGATAACTCGAGTTATCTTCCGAACACCGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003442.3-1758s1c1
Sequence:CCGGCGCACTCTGTTGCTATGGTTACTCGAGTAACCATAGCAACAGAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003442.3-371s1c1
Sequence:CCGGGCGGCCTATGTTCAACATGTACTCGAGTACATGTTGAACATAGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003442.3-2037s1c1
Sequence:CCGGCCTCAGAACAATGGAGCAATACTCGAGTATTGCTCCATTGTTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003442.3-1348s1c1
Sequence:CCGGCCACACTCATTCCAAACCTTACTCGAGTAAGGTTTGGAATGAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003442.3-782s1c1
Sequence:CCGGGCTACAAGAGTAACTGCTAAACTCGAGTTTAGCAGTTACTCTTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003442
ZNF143 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 143
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003442.5-2256s21c1
Sequence:CCGGATTAGGGCAATACAGTAAATTCTCGAGAATTTACTGTATTGCCCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003442.5-1007s21c1
Sequence:CCGGATATCGGTGTTCGGAAGATAACTCGAGTTATCTTCCGAACACCGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003442.3-1758s1c1
Sequence:CCGGCGCACTCTGTTGCTATGGTTACTCGAGTAACCATAGCAACAGAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003442.3-371s1c1
Sequence:CCGGGCGGCCTATGTTCAACATGTACTCGAGTACATGTTGAACATAGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003442.3-2037s1c1
Sequence:CCGGCCTCAGAACAATGGAGCAATACTCGAGTATTGCTCCATTGTTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003442.3-1348s1c1
Sequence:CCGGCCACACTCATTCCAAACCTTACTCGAGTAAGGTTTGGAATGAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003442.3-782s1c1
Sequence:CCGGGCTACAAGAGTAACTGCTAAACTCGAGTTTAGCAGTTACTCTTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003442
ZNF143 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 143
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003442.5-2256s21c1
Sequence:CCGGATTAGGGCAATACAGTAAATTCTCGAGAATTTACTGTATTGCCCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003442.5-1007s21c1
Sequence:CCGGATATCGGTGTTCGGAAGATAACTCGAGTTATCTTCCGAACACCGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003442.3-1758s1c1
Sequence:CCGGCGCACTCTGTTGCTATGGTTACTCGAGTAACCATAGCAACAGAGTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003442.3-371s1c1
Sequence:CCGGGCGGCCTATGTTCAACATGTACTCGAGTACATGTTGAACATAGGCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012933    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003442.3-2037s1c1
Sequence:CCGGCCTCAGAACAATGGAGCAATACTCGAGTATTGCTCCATTGTTCTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003442.3-1348s1c1
Sequence:CCGGCCACACTCATTCCAAACCTTACTCGAGTAAGGTTTGGAATGAGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003442.3-782s1c1
Sequence:CCGGGCTACAAGAGTAACTGCTAAACTCGAGTTTAGCAGTTACTCTTGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks