EMAIL THIS PAGE TO A FRIEND

ZNF146

zinc finger protein 146

Synonyms: OZF
UniProtKB ID: Q15072, Q2TB94
Gene ID:
domestic cat(101085764) zinc finger protein 146
cow(282395) zinc finger protein 146
sheep(101102922) zinc finger protein 146
cow(100138954) zinc finger protein 146
naked mole-rat(101722615) zinc finger protein 146
domestic guinea pig(100730718) zinc finger protein 146
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003358 Anti-ZNF146 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2102801 Anti-ZNF146 antibody produced in rabbit affinity isolated antibody human, bovine, rat, mouse, rabbit, horse
western blot pricing
SAB2104654 Anti-ZNF146 antibody produced in rabbit affinity isolated antibody rabbit, rat, bovine, mouse, horse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007145 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007145 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007145 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010911 MISSION® esiRNA esiRNA targeting human ZNF146 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099638 Rosetta Predictions human pricing
NM_001099639 Rosetta Predictions human pricing
NM_007145 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320819 predicted 2235
2 SASI_Hs02_00320820 predicted 2052
3 SASI_Hs02_00320821 predicted 2050
4 SASI_Hs02_00320822 predicted 1939
5 SASI_Hs02_00320823 predicted 2020
6 SASI_Hs02_00320824 predicted 2391
7 SASI_Hs02_00320825 predicted 2333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320826 predicted 2189
2 SASI_Hs02_00320827 predicted 2012
3 SASI_Hs02_00320828 predicted 2010
4 SASI_Hs02_00320829 predicted 1897
5 SASI_Hs02_00320830 predicted 1977
6 SASI_Hs02_00320831 predicted 2342
7 SASI_Hs02_00320832 predicted 2297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187181 predicted 2301
2 SASI_Hs01_00187182 predicted 2125
3 SASI_Hs01_00187183 predicted 2131
4 SASI_Hs01_00187185 predicted 2020
5 SASI_Hs01_00187184 predicted 2093
6 SASI_Hs01_00187186 predicted 2462
7 SASI_Hs01_00187187 predicted 2407
8 SASI_Hs01_00187188 predicted 1767
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007145
VALIDATED
ZNF146 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 146
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007145.1-1797s1c1
Sequence:CCGGCCCAGAAATAATCCTTCTGAACTCGAGTTCAGAAGGATTATTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007145.1-946s1c1
Sequence:CCGGCCTCACTGAGCATGAGCATTTCTCGAGAAATGCTCATGCTCAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007145.1-1439s1c1
Sequence:CCGGCAGCGAACATCACTTATTGTACTCGAGTACAATAAGTGATGTTCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007145.1-1266s1c1
Sequence:CCGGTCAGTGGCAAATCCAACCTTACTCGAGTAAGGTTGGATTTGCCACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007145.2-2493s21c1
Sequence:CCGGCCACGAATGAGGTTAACTTTACTCGAGTAAAGTTAACCTCATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007145.2-1694s21c1
Sequence:CCGGGTATGTCATTAAACATCAGAACTCGAGTTCTGATGTTTAATGACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007145.2-1613s21c1
Sequence:CCGGCCTCACTGAGCATGAGCATTTCTCGAGAAATGCTCATGCTCAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007145.2-2280s21c1
Sequence:CCGGTCAACCCTTGCTCTGCATTTGCTCGAGCAAATGCAGAGCAAGGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007145.2-2020s21c1
Sequence:CCGGGCCAGAAGAAGTACCTCATAACTCGAGTTATGAGGTACTTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007145
VALIDATED
ZNF146 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 146
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007145.1-1797s1c1
Sequence:CCGGCCCAGAAATAATCCTTCTGAACTCGAGTTCAGAAGGATTATTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007145.1-946s1c1
Sequence:CCGGCCTCACTGAGCATGAGCATTTCTCGAGAAATGCTCATGCTCAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007145.1-1439s1c1
Sequence:CCGGCAGCGAACATCACTTATTGTACTCGAGTACAATAAGTGATGTTCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007145.1-1266s1c1
Sequence:CCGGTCAGTGGCAAATCCAACCTTACTCGAGTAAGGTTGGATTTGCCACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007145.2-2493s21c1
Sequence:CCGGCCACGAATGAGGTTAACTTTACTCGAGTAAAGTTAACCTCATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007145.2-1694s21c1
Sequence:CCGGGTATGTCATTAAACATCAGAACTCGAGTTCTGATGTTTAATGACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007145.2-1613s21c1
Sequence:CCGGCCTCACTGAGCATGAGCATTTCTCGAGAAATGCTCATGCTCAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007145.2-2280s21c1
Sequence:CCGGTCAACCCTTGCTCTGCATTTGCTCGAGCAAATGCAGAGCAAGGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007145.2-2020s21c1
Sequence:CCGGGCCAGAAGAAGTACCTCATAACTCGAGTTATGAGGTACTTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007145
VALIDATED
ZNF146 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 146
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007145.1-1797s1c1
Sequence:CCGGCCCAGAAATAATCCTTCTGAACTCGAGTTCAGAAGGATTATTTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007145.1-946s1c1
Sequence:CCGGCCTCACTGAGCATGAGCATTTCTCGAGAAATGCTCATGCTCAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007145.1-1439s1c1
Sequence:CCGGCAGCGAACATCACTTATTGTACTCGAGTACAATAAGTGATGTTCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007145.1-1266s1c1
Sequence:CCGGTCAGTGGCAAATCCAACCTTACTCGAGTAAGGTTGGATTTGCCACTGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274237    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007145.2-2493s21c1
Sequence:CCGGCCACGAATGAGGTTAACTTTACTCGAGTAAAGTTAACCTCATTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007145.2-1694s21c1
Sequence:CCGGGTATGTCATTAAACATCAGAACTCGAGTTCTGATGTTTAATGACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007145.2-1613s21c1
Sequence:CCGGCCTCACTGAGCATGAGCATTTCTCGAGAAATGCTCATGCTCAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007145.2-2280s21c1
Sequence:CCGGTCAACCCTTGCTCTGCATTTGCTCGAGCAAATGCAGAGCAAGGGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_007145.2-2020s21c1
Sequence:CCGGGCCAGAAGAAGTACCTCATAACTCGAGTTATGAGGTACTTCTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks