EMAIL THIS PAGE TO A FRIEND

ZNF148

zinc finger protein 148

Synonyms: BERF-1 BFCOL1 HT-BETA ZBP-89 ZFP148 pHZ-52
UniProtKB ID: Q9UQR1, D3DN27, O00389, O43591, Q58EY5
Gene ID:
domestic guinea pig(100725818) zinc finger protein 148
naked mole-rat(101703761) zinc finger protein 148
cow(613265) zinc finger protein 148
Zebrafish(560300) zinc finger protein 148
domestic cat(101095848) zinc finger protein 148
dog(488017) zinc finger protein 148
chicken(424259) zinc finger protein 148
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102802 Anti-ZNF148 antibody produced in rabbit affinity isolated antibody human, rabbit, canine, bovine, mouse, rat, guinea pig, horse
western blot pricing
SAB2104156 Anti-ZNF148 antibody produced in rabbit affinity isolated antibody mouse, rat, guinea pig, bovine, human, pig, rabbit, horse, zebrafish, canine
western blot pricing
HPA001656 ANTI-ZNF148 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB4503125 Anti-ZNF148, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021964 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021964 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021964 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021964 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093929 predicted 2172
2 SASI_Hs01_00093930 predicted 1803
3 SASI_Hs01_00093931 predicted 918
4 SASI_Hs01_00093933 predicted 1843
5 SASI_Hs02_00355306 predicted 817
6 SASI_Hs01_00093935 predicted 1178
7 SASI_Hs01_00093936 predicted 2242
8 SASI_Hs02_00355307 predicted 1096
9 SASI_Hs01_00093937 predicted 1945
10 SASI_Hs01_00093938 predicted 2448
11 SASI_Hs01_00093932 predicted 994
12 SASI_Hs01_00093934 predicted 400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021964
VALIDATED
ZNF148 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 148
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_021964.2-804s21c1
Sequence:CCGGTGCACTTAATGTCCCTATAAGCTCGAGCTTATAGGGACATTAAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_021964.2-1813s21c1
Sequence:CCGGGACATTGATCAGGTTGATAATCTCGAGATTATCAACCTGATCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_021964.2-6098s21c1
Sequence:CCGGTACTTGAAGAAGCACTATAATCTCGAGATTATAGTGCTTCTTCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_021964.2-1855s21c1
Sequence:GTACCGGCCTGTGCATAGTAGTACTAATCTCGAGATTAGTACTACTATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_021964.2-2020s21c1
Sequence:CCGGAGTACCACGGCATCCATATTACTCGAGTAATATGGATGCCGTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021964.1-2872s1c1
Sequence:CCGGGCAATGCGTAATAACAAGTTACTCGAGTAACTTGTTATTACGCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021964.1-1549s1c1
Sequence:CCGGCCCACCTAAGTTAGTTCTCAACTCGAGTTGAGAACTAACTTAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021964.1-2364s1c1
Sequence:CCGGGCTTTCGATCAGGAATGAATTCTCGAGAATTCATTCCTGATCGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021964.1-438s1c1
Sequence:CCGGGCATAGACGAAATGCAGTCTTCTCGAGAAGACTGCATTTCGTCTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021964.1-1650s1c1
Sequence:CCGGGCAAAGTTTCAAAGTATGCTTCTCGAGAAGCATACTTTGAAACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021964
VALIDATED
ZNF148 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 148
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_021964.2-804s21c1
Sequence:CCGGTGCACTTAATGTCCCTATAAGCTCGAGCTTATAGGGACATTAAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_021964.2-1813s21c1
Sequence:CCGGGACATTGATCAGGTTGATAATCTCGAGATTATCAACCTGATCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_021964.2-6098s21c1
Sequence:CCGGTACTTGAAGAAGCACTATAATCTCGAGATTATAGTGCTTCTTCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_021964.2-1855s21c1
Sequence:GTACCGGCCTGTGCATAGTAGTACTAATCTCGAGATTAGTACTACTATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_021964.2-2020s21c1
Sequence:CCGGAGTACCACGGCATCCATATTACTCGAGTAATATGGATGCCGTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021964.1-2872s1c1
Sequence:CCGGGCAATGCGTAATAACAAGTTACTCGAGTAACTTGTTATTACGCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021964.1-1549s1c1
Sequence:CCGGCCCACCTAAGTTAGTTCTCAACTCGAGTTGAGAACTAACTTAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021964.1-2364s1c1
Sequence:CCGGGCTTTCGATCAGGAATGAATTCTCGAGAATTCATTCCTGATCGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021964.1-438s1c1
Sequence:CCGGGCATAGACGAAATGCAGTCTTCTCGAGAAGACTGCATTTCGTCTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021964.1-1650s1c1
Sequence:CCGGGCAAAGTTTCAAAGTATGCTTCTCGAGAAGCATACTTTGAAACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021964
VALIDATED
ZNF148 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 148
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_021964.2-804s21c1
Sequence:CCGGTGCACTTAATGTCCCTATAAGCTCGAGCTTATAGGGACATTAAGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_021964.2-1813s21c1
Sequence:CCGGGACATTGATCAGGTTGATAATCTCGAGATTATCAACCTGATCAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230463    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_021964.2-6098s21c1
Sequence:CCGGTACTTGAAGAAGCACTATAATCTCGAGATTATAGTGCTTCTTCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_021964.2-1855s21c1
Sequence:GTACCGGCCTGTGCATAGTAGTACTAATCTCGAGATTAGTACTACTATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_021964.2-2020s21c1
Sequence:CCGGAGTACCACGGCATCCATATTACTCGAGTAATATGGATGCCGTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021964.1-2872s1c1
Sequence:CCGGGCAATGCGTAATAACAAGTTACTCGAGTAACTTGTTATTACGCATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021964.1-1549s1c1
Sequence:CCGGCCCACCTAAGTTAGTTCTCAACTCGAGTTGAGAACTAACTTAGGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021964.1-2364s1c1
Sequence:CCGGGCTTTCGATCAGGAATGAATTCTCGAGAATTCATTCCTGATCGAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021964.1-438s1c1
Sequence:CCGGGCATAGACGAAATGCAGTCTTCTCGAGAAGACTGCATTTCGTCTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021964.1-1650s1c1
Sequence:CCGGGCAAAGTTTCAAAGTATGCTTCTCGAGAAGCATACTTTGAAACTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks