EMAIL THIS PAGE TO A FRIEND

ZNF14

zinc finger protein 14

Synonyms: GIOT-4 KOX6
Species: Human ZNF14(7561), dog ZNF14(611075), naked mole-rat Znf14(101709872), domestic guinea pig Znf14(100715003)
UniProtKB ID: P17017, B9EGA4, Q9ULZ5
Gene ID:
Human(7561) Summary: The protein encoded by this gene contains a zinc finger and a Kruppel-associated box (KRAB) domain. KRAB domain is known to be involved in the transcriptional repression of a number of zinc finger proteins. [provided by RefSeq, Jul 2008]
dog(611075) zinc finger protein 14
naked mole-rat(101709872) zinc finger protein 14
domestic guinea pig(100715003) zinc finger protein 14
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV51595 Anti-ZNF14 antibody produced in rabbit affinity isolated antibody human, rat, zebrafish, rabbit, bovine, horse, pig, mouse
western blot pricing
HPA049863 Anti-ZNF14 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021030 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021030 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021030 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021030 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055342 predicted 1864
2 SASI_Hs01_00055343 predicted 2088
3 SASI_Hs01_00055344 predicted 346
4 SASI_Hs01_00055345 predicted 1774
5 SASI_Hs02_00354504 predicted 1270
6 SASI_Hs02_00354505 predicted 2036
7 SASI_Hs01_00055347 predicted 302
8 SASI_Hs02_00354506 predicted 1865
9 SASI_Hs01_00055348 predicted 934
10 SASI_Hs01_00055349 predicted 2021
11 SASI_Hs01_00055346 predicted 932
12 SASI_Hs01_00055350 predicted 1948
13 SASI_Hs01_00055351 predicted 1625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021030
ZNF14 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 14
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021030.2-1264s21c1
Sequence:CCGGATCATTCAGTTGGTCCATTTCCTCGAGGAAATGGACCAACTGAATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021030.2-409s21c1
Sequence:CCGGCCAGATGCCAAATGTTAATATCTCGAGATATTAACATTTGGCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021030.2-2421s1c1
Sequence:CCGGGCAGATCATTTGAGGTCAGAACTCGAGTTCTGACCTCAAATGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021030.2-1770s1c1
Sequence:CCGGCCTTCCTTCGTTCCAGTCAAACTCGAGTTTGACTGGAACGAAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021030.2-1148s1c1
Sequence:CCGGGCTCGACCTTATAAATGTAAACTCGAGTTTACATTTATAAGGTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021030.2-490s1c1
Sequence:CCGGCATTCATCATTCGTCCCTTAACTCGAGTTAAGGGACGAATGATGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021030.2-1328s1c1
Sequence:CCGGGAGTGTAAACAGTGTCATAAACTCGAGTTTATGACACTGTTTACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021030
ZNF14 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 14
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021030.2-1264s21c1
Sequence:CCGGATCATTCAGTTGGTCCATTTCCTCGAGGAAATGGACCAACTGAATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021030.2-409s21c1
Sequence:CCGGCCAGATGCCAAATGTTAATATCTCGAGATATTAACATTTGGCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021030.2-2421s1c1
Sequence:CCGGGCAGATCATTTGAGGTCAGAACTCGAGTTCTGACCTCAAATGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021030.2-1770s1c1
Sequence:CCGGCCTTCCTTCGTTCCAGTCAAACTCGAGTTTGACTGGAACGAAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021030.2-1148s1c1
Sequence:CCGGGCTCGACCTTATAAATGTAAACTCGAGTTTACATTTATAAGGTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021030.2-490s1c1
Sequence:CCGGCATTCATCATTCGTCCCTTAACTCGAGTTAAGGGACGAATGATGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021030.2-1328s1c1
Sequence:CCGGGAGTGTAAACAGTGTCATAAACTCGAGTTTATGACACTGTTTACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021030
ZNF14 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 14
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021030.2-1264s21c1
Sequence:CCGGATCATTCAGTTGGTCCATTTCCTCGAGGAAATGGACCAACTGAATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021030.2-409s21c1
Sequence:CCGGCCAGATGCCAAATGTTAATATCTCGAGATATTAACATTTGGCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021030.2-2421s1c1
Sequence:CCGGGCAGATCATTTGAGGTCAGAACTCGAGTTCTGACCTCAAATGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021030.2-1770s1c1
Sequence:CCGGCCTTCCTTCGTTCCAGTCAAACTCGAGTTTGACTGGAACGAAGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021030.2-1148s1c1
Sequence:CCGGGCTCGACCTTATAAATGTAAACTCGAGTTTACATTTATAAGGTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021030.2-490s1c1
Sequence:CCGGCATTCATCATTCGTCCCTTAACTCGAGTTAAGGGACGAATGATGAATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021030.2-1328s1c1
Sequence:CCGGGAGTGTAAACAGTGTCATAAACTCGAGTTTATGACACTGTTTACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks