EMAIL THIS PAGE TO A FRIEND

ZNF154

zinc finger protein 154

Synonyms: pHZ-92
UniProtKB ID: Q13106, A7MCY3, Q8IVG7, Q8NAR0
Gene ID:
cow(789970) zinc finger protein 154
naked mole-rat(101696717) zinc finger protein 154
14 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003444 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085384 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085384 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085384 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085384 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317556 predicted 1593
2 SASI_Hs02_00317557 predicted 1577
3 SASI_Hs02_00317558 predicted 1594
4 SASI_Hs02_00317559 predicted 914
5 SASI_Hs02_00317560 predicted 1178
6 SASI_Hs02_00317561 predicted 1079
7 SASI_Hs02_00317562 predicted 1377
8 SASI_Hs02_00317563 predicted 916
9 SASI_Hs02_00317564 predicted 911
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003444
ZNF154 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 154
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003444.1-1743s1c1
Sequence:CCGGGCCTGAATTGAACATCCTATACTCGAGTATAGGATGTTCAATTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003444.1-905s1c1
Sequence:CCGGGCAACAAGTCTAACCTCATTACTCGAGTAATGAGGTTAGACTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003444.1-683s1c1
Sequence:CCGGGAACCCTCACTACAGAAAGATCTCGAGATCTTTCTGTAGTGAGGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003444.1-1505s1c1
Sequence:CCGGGCCTTATTAAACATCAGAGAACTCGAGTTCTCTGATGTTTAATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003444.1-1073s1c1
Sequence:CCGGCATATCATTCCAGTCTCATAACTCGAGTTATGAGACTGGAATGATATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003444
ZNF154 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 154
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003444.1-1743s1c1
Sequence:CCGGGCCTGAATTGAACATCCTATACTCGAGTATAGGATGTTCAATTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003444.1-905s1c1
Sequence:CCGGGCAACAAGTCTAACCTCATTACTCGAGTAATGAGGTTAGACTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003444.1-683s1c1
Sequence:CCGGGAACCCTCACTACAGAAAGATCTCGAGATCTTTCTGTAGTGAGGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003444.1-1505s1c1
Sequence:CCGGGCCTTATTAAACATCAGAGAACTCGAGTTCTCTGATGTTTAATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003444.1-1073s1c1
Sequence:CCGGCATATCATTCCAGTCTCATAACTCGAGTTATGAGACTGGAATGATATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003444
ZNF154 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 154
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012958    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003444.1-1743s1c1
Sequence:CCGGGCCTGAATTGAACATCCTATACTCGAGTATAGGATGTTCAATTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003444.1-905s1c1
Sequence:CCGGGCAACAAGTCTAACCTCATTACTCGAGTAATGAGGTTAGACTTGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003444.1-683s1c1
Sequence:CCGGGAACCCTCACTACAGAAAGATCTCGAGATCTTTCTGTAGTGAGGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003444.1-1505s1c1
Sequence:CCGGGCCTTATTAAACATCAGAGAACTCGAGTTCTCTGATGTTTAATAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003444.1-1073s1c1
Sequence:CCGGCATATCATTCCAGTCTCATAACTCGAGTTATGAGACTGGAATGATATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085384
ZNF154 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 154
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000432702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085384.1-1725s21c1
Sequence:CCGGCTCTGAAGGAGATCCCTTATGCTCGAGCATAAGGGATCTCCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085384.1-1699s21c1
Sequence:CCGGGTAGGGATGTCCAGTTGATATCTCGAGATATCAACTGGACATCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085384
ZNF154 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 154
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000432702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085384.1-1725s21c1
Sequence:CCGGCTCTGAAGGAGATCCCTTATGCTCGAGCATAAGGGATCTCCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085384.1-1699s21c1
Sequence:CCGGGTAGGGATGTCCAGTTGATATCTCGAGATATCAACTGGACATCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085384
ZNF154 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 154
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000432702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085384.1-1725s21c1
Sequence:CCGGCTCTGAAGGAGATCCCTTATGCTCGAGCATAAGGGATCTCCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085384.1-1699s21c1
Sequence:CCGGGTAGGGATGTCCAGTTGATATCTCGAGATATCAACTGGACATCCCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks