EMAIL THIS PAGE TO A FRIEND

ZNF155

zinc finger protein 155

Synonyms: pHZ-96
Species: Human ZNF155(7711)
Gene ID:
27 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003445 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003445 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003445 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003445 Rosetta Predictions human pricing
NM_198089 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003445 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083780 predicted 935
2 SASI_Hs01_00083781 predicted 1073
3 SASI_Hs01_00083782 predicted 544
4 SASI_Hs01_00083783 predicted 343
5 SASI_Hs01_00083784 predicted 718
6 SASI_Hs01_00083785 predicted 1252
7 SASI_Hs01_00083786 predicted 614
8 SASI_Hs01_00083787 predicted 1502
9 SASI_Hs01_00083788 predicted 1104
10 SASI_Hs01_00083789 predicted 1680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084119 predicted 854
2 SASI_Hs01_00084120 predicted 996
3 SASI_Hs01_00084121 predicted 467
4 SASI_Hs01_00084122 predicted 266
5 SASI_Hs01_00084123 predicted 641
6 SASI_Hs01_00084124 predicted 1181
7 SASI_Hs01_00084125 predicted 538
8 SASI_Hs01_00084126 predicted 1425
9 SASI_Hs01_00084127 predicted 1032
10 SASI_Hs01_00084128 predicted 1599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003445
ZNF155 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 155
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003445.2-544s21c1
Sequence:CCGGGTCTCAGGACTCTATCATAAACTCGAGTTTATGATAGAGTCCTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003445.2-832s21c1
Sequence:CCGGTGGCAAGGAATTTAGTCAAAGCTCGAGCTTTGACTAAATTCCTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003445.2-1876s21c1
Sequence:CCGGTAGTGATCCAATCAGTGTAATCTCGAGATTACACTGATTGGATCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003445.2-1509s21c1
Sequence:CCGGAGGGCTATGTTACTAAGTTTACTCGAGTAAACTTAGTAACATAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003445.2-2435s1c1
Sequence:CCGGGCCAAGCTGAATAGCCCTTATCTCGAGATAAGGGCTATTCAGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003445.2-608s1c1
Sequence:CCGGGAAGCAGGACTACCCACAATTCTCGAGAATTGTGGGTAGTCCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003445.2-1557s1c1
Sequence:CCGGCGGGAGAGAGACCTTATAATTCTCGAGAATTATAAGGTCTCTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003445.2-941s1c1
Sequence:CCGGGCACTTAATGTTCATCGTAAACTCGAGTTTACGATGAACATTAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003445.2-1260s1c1
Sequence:CCGGGCTTTATTGGTAGGCTAGATTCTCGAGAATCTAGCCTACCAATAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003445
ZNF155 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 155
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003445.2-544s21c1
Sequence:CCGGGTCTCAGGACTCTATCATAAACTCGAGTTTATGATAGAGTCCTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003445.2-832s21c1
Sequence:CCGGTGGCAAGGAATTTAGTCAAAGCTCGAGCTTTGACTAAATTCCTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003445.2-1876s21c1
Sequence:CCGGTAGTGATCCAATCAGTGTAATCTCGAGATTACACTGATTGGATCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003445.2-1509s21c1
Sequence:CCGGAGGGCTATGTTACTAAGTTTACTCGAGTAAACTTAGTAACATAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003445.2-2435s1c1
Sequence:CCGGGCCAAGCTGAATAGCCCTTATCTCGAGATAAGGGCTATTCAGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003445.2-608s1c1
Sequence:CCGGGAAGCAGGACTACCCACAATTCTCGAGAATTGTGGGTAGTCCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003445.2-1557s1c1
Sequence:CCGGCGGGAGAGAGACCTTATAATTCTCGAGAATTATAAGGTCTCTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003445.2-941s1c1
Sequence:CCGGGCACTTAATGTTCATCGTAAACTCGAGTTTACGATGAACATTAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003445.2-1260s1c1
Sequence:CCGGGCTTTATTGGTAGGCTAGATTCTCGAGAATCTAGCCTACCAATAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003445
ZNF155 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 155
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003445.2-544s21c1
Sequence:CCGGGTCTCAGGACTCTATCATAAACTCGAGTTTATGATAGAGTCCTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003445.2-832s21c1
Sequence:CCGGTGGCAAGGAATTTAGTCAAAGCTCGAGCTTTGACTAAATTCCTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418325    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003445.2-1876s21c1
Sequence:CCGGTAGTGATCCAATCAGTGTAATCTCGAGATTACACTGATTGGATCACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003445.2-1509s21c1
Sequence:CCGGAGGGCTATGTTACTAAGTTTACTCGAGTAAACTTAGTAACATAGCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003445.2-2435s1c1
Sequence:CCGGGCCAAGCTGAATAGCCCTTATCTCGAGATAAGGGCTATTCAGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003445.2-608s1c1
Sequence:CCGGGAAGCAGGACTACCCACAATTCTCGAGAATTGTGGGTAGTCCTGCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003445.2-1557s1c1
Sequence:CCGGCGGGAGAGAGACCTTATAATTCTCGAGAATTATAAGGTCTCTCTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003445.2-941s1c1
Sequence:CCGGGCACTTAATGTTCATCGTAAACTCGAGTTTACGATGAACATTAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003445.2-1260s1c1
Sequence:CCGGGCTTTATTGGTAGGCTAGATTCTCGAGAATCTAGCCTACCAATAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks