EMAIL THIS PAGE TO A FRIEND

ZNF157

zinc finger protein 157

Synonyms: HZF22
UniProtKB ID: P51786, Q96LE9
Gene ID:
Human(7712) Summary: This gene product is a likely zinc finger family transcription factor. It contains KRAB-A and KRAB-B domains that act as transcriptional repressors in related proteins, and multiple zinc finger DNA binding motifs and finger linking regions characteristic of the Kruppel family. This gene is part of a gene cluster on chromosome Xp11.23. [provided by RefSeq, Jul 2008]
dog(612509) zinc finger protein 157
Horse(100060873) zinc finger protein 157
domestic cat(101095403) zinc finger protein 157
naked mole-rat(101721500) zinc finger protein 157
domestic guinea pig(100714627) zinc finger protein 157
cow(786724) zinc finger protein 157
sheep(101117142) zinc finger protein 157
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003446 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003446 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003446 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003446 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003446 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022294 predicted 1407
2 SASI_Hs02_00335674 predicted 424
3 SASI_Hs01_00022295 predicted 415
4 SASI_Hs01_00022296 predicted 1069
5 SASI_Hs01_00022297 predicted 441
6 SASI_Hs01_00022298 predicted 1071
7 SASI_Hs01_00022299 predicted 1013
8 SASI_Hs01_00022301 predicted 1249
9 SASI_Hs02_00335675 predicted 910
10 SASI_Hs02_00335676 predicted 468
11 SASI_Hs01_00022292 predicted 876
12 SASI_Hs01_00022293 predicted 1197
13 SASI_Hs01_00022300 predicted 1430
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003446
ZNF157 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 157
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003446.2-1754s1c1
Sequence:CCGGCCCTAATTAGTGGTGTGTGAACTCGAGTTCACACACCACTAATTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003446.2-1020s1c1
Sequence:CCGGCGTGCAAAGAAATCCCTAAATCTCGAGATTTAGGGATTTCTTTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003446.2-1254s1c1
Sequence:CCGGGAGTGTGGTAATGCTTTCTATCTCGAGATAGAAAGCATTACCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003446.2-683s1c1
Sequence:CCGGCAGTGCAAGATCATACCTCATCTCGAGATGAGGTATGATCTTGCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003446.2-455s1c1
Sequence:CCGGCCATCAGAAGATTCAAACATTCTCGAGAATGTTTGAATCTTCTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003446.3-1424s21c1
Sequence:CCGGATGTGAAAGTACGCCTCATTGCTCGAGCAATGAGGCGTACTTTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003446.3-508s21c1
Sequence:CCGGACAGGCTTTGTTAGACGTAAACTCGAGTTTACGTCTAACAAAGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003446.3-577s21c1
Sequence:CCGGGCTTACTGTAGGAAGTCAAACCTCGAGGTTTGACTTCCTACAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003446
ZNF157 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 157
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003446.2-1754s1c1
Sequence:CCGGCCCTAATTAGTGGTGTGTGAACTCGAGTTCACACACCACTAATTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003446.2-1020s1c1
Sequence:CCGGCGTGCAAAGAAATCCCTAAATCTCGAGATTTAGGGATTTCTTTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003446.2-1254s1c1
Sequence:CCGGGAGTGTGGTAATGCTTTCTATCTCGAGATAGAAAGCATTACCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003446.2-683s1c1
Sequence:CCGGCAGTGCAAGATCATACCTCATCTCGAGATGAGGTATGATCTTGCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003446.2-455s1c1
Sequence:CCGGCCATCAGAAGATTCAAACATTCTCGAGAATGTTTGAATCTTCTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003446.3-1424s21c1
Sequence:CCGGATGTGAAAGTACGCCTCATTGCTCGAGCAATGAGGCGTACTTTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003446.3-508s21c1
Sequence:CCGGACAGGCTTTGTTAGACGTAAACTCGAGTTTACGTCTAACAAAGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003446.3-577s21c1
Sequence:CCGGGCTTACTGTAGGAAGTCAAACCTCGAGGTTTGACTTCCTACAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003446
ZNF157 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 157
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012968    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003446.2-1754s1c1
Sequence:CCGGCCCTAATTAGTGGTGTGTGAACTCGAGTTCACACACCACTAATTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003446.2-1020s1c1
Sequence:CCGGCGTGCAAAGAAATCCCTAAATCTCGAGATTTAGGGATTTCTTTGCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003446.2-1254s1c1
Sequence:CCGGGAGTGTGGTAATGCTTTCTATCTCGAGATAGAAAGCATTACCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003446.2-683s1c1
Sequence:CCGGCAGTGCAAGATCATACCTCATCTCGAGATGAGGTATGATCTTGCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003446.2-455s1c1
Sequence:CCGGCCATCAGAAGATTCAAACATTCTCGAGAATGTTTGAATCTTCTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003446.3-1424s21c1
Sequence:CCGGATGTGAAAGTACGCCTCATTGCTCGAGCAATGAGGCGTACTTTCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003446.3-508s21c1
Sequence:CCGGACAGGCTTTGTTAGACGTAAACTCGAGTTTACGTCTAACAAAGCCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420025    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003446.3-577s21c1
Sequence:CCGGGCTTACTGTAGGAAGTCAAACCTCGAGGTTTGACTTCCTACAGTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks