EMAIL THIS PAGE TO A FRIEND

ZNF160

zinc finger protein 160

Synonyms: F11 HKr18 HZF5 KR18
Species: Human ZNF160(90338), naked mole-rat Znf160(101702171)
UniProtKB ID: Q9HCG1, Q14589, Q504Q8, Q96JC5, Q9H7N6
Gene ID:
Human(90338) Summary: The protein encoded by this gene is a Kruppel-related zinc finger protein which is characterized by the presence of an N-terminal repressor domain, the Kruppel-associated box (KRAB). The KRAB domain is a potent repressor of transcription; thus this protein may function in transcription regulation. Three alternative transcripts encoding the same protein have been described. [provided by RefSeq, Jul 2008]
naked mole-rat(101702171) zinc finger protein 160
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033288 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079351 MISSION® esiRNA esiRNA human ZNF160 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102603 Rosetta Predictions human pricing
NM_033288 Rosetta Predictions human pricing
NM_198893 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323370 predicted 1393
2 SASI_Hs02_00323371 predicted 2899
3 SASI_Hs02_00323372 predicted 678
4 SASI_Hs02_00323373 predicted 1078
5 SASI_Hs02_00323374 predicted 1478
6 SASI_Hs02_00323375 predicted 1312
7 SASI_Hs02_00323376 predicted 2814
8 SASI_Hs02_00323377 predicted 1559
9 SASI_Hs02_00323378 predicted 2828
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246581 predicted 1282
2 SASI_Hs01_00246583 predicted 2790
3 SASI_Hs01_00246584 predicted 565
4 SASI_Hs01_00246585 predicted 960
5 SASI_Hs01_00246586 predicted 1363
6 SASI_Hs01_00246587 predicted 1196
7 SASI_Hs01_00246588 predicted 2695
8 SASI_Hs02_00361097 predicted 1445
9 SASI_Hs01_00246589 predicted 2712
10 SASI_Hs01_00246582 predicted 2571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014785 predicted 2293
2 SASI_Hs02_00372396 predicted 2869
3 SASI_Hs01_00014787 predicted 649
4 SASI_Hs01_00014788 predicted 1048
5 SASI_Hs01_00014789 predicted 1445
6 SASI_Hs01_00014790 predicted 1279
7 SASI_Hs01_00014791 predicted 2779
8 SASI_Hs02_00372397 predicted 1526
9 SASI_Hs01_00014792 predicted 2796
10 SASI_Hs01_00014786 predicted 2647
11 SASI_Hs01_00014793 predicted 807
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033288
ZNF160 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 160
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033288.2-2529s1c1
Sequence:CCGGCCTGGCAAATCACCGAAGAATCTCGAGATTCTTCGGTGATTTGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033288.2-564s1c1
Sequence:CCGGCCCTCCTAAATGTACAATCAACTCGAGTTGATTGTACATTTAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033288.2-1520s1c1
Sequence:CCGGGCCTAGCAATCCATCAGACAACTCGAGTTGTCTGATGGATTGCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033288.2-787s1c1
Sequence:CCGGCGCGACAGAAGAGACATAGAACTCGAGTTCTATGTCTCTTCTGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033288.2-2404s1c1
Sequence:CCGGCGATGCAATGAGTGTGGGAAACTCGAGTTTCCCACACTCATTGCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033288.3-538s21c1
Sequence:CCGGGAACGCCGGAATGTGTCAAAGCTCGAGCTTTGACACATTCCGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033288.3-1185s21c1
Sequence:CCGGGTTCGTTCAAATCTAACTATTCTCGAGAATAGTTAGATTTGAACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033288.3-2009s21c1
Sequence:CCGGTGGTAAAGTCTTCGCTCAAACCTCGAGGTTTGAGCGAAGACTTTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033288.3-3097s21c1
Sequence:CCGGGAATACTCACAAGTCCAAATACTCGAGTATTTGGACTTGTGAGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033288
ZNF160 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 160
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033288.2-2529s1c1
Sequence:CCGGCCTGGCAAATCACCGAAGAATCTCGAGATTCTTCGGTGATTTGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033288.2-564s1c1
Sequence:CCGGCCCTCCTAAATGTACAATCAACTCGAGTTGATTGTACATTTAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033288.2-1520s1c1
Sequence:CCGGGCCTAGCAATCCATCAGACAACTCGAGTTGTCTGATGGATTGCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033288.2-787s1c1
Sequence:CCGGCGCGACAGAAGAGACATAGAACTCGAGTTCTATGTCTCTTCTGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033288.2-2404s1c1
Sequence:CCGGCGATGCAATGAGTGTGGGAAACTCGAGTTTCCCACACTCATTGCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033288.3-538s21c1
Sequence:CCGGGAACGCCGGAATGTGTCAAAGCTCGAGCTTTGACACATTCCGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033288.3-1185s21c1
Sequence:CCGGGTTCGTTCAAATCTAACTATTCTCGAGAATAGTTAGATTTGAACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033288.3-2009s21c1
Sequence:CCGGTGGTAAAGTCTTCGCTCAAACCTCGAGGTTTGAGCGAAGACTTTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033288.3-3097s21c1
Sequence:CCGGGAATACTCACAAGTCCAAATACTCGAGTATTTGGACTTGTGAGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033288
ZNF160 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 160
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033288.2-2529s1c1
Sequence:CCGGCCTGGCAAATCACCGAAGAATCTCGAGATTCTTCGGTGATTTGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033288.2-564s1c1
Sequence:CCGGCCCTCCTAAATGTACAATCAACTCGAGTTGATTGTACATTTAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033288.2-1520s1c1
Sequence:CCGGGCCTAGCAATCCATCAGACAACTCGAGTTGTCTGATGGATTGCTAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033288.2-787s1c1
Sequence:CCGGCGCGACAGAAGAGACATAGAACTCGAGTTCTATGTCTCTTCTGTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033288.2-2404s1c1
Sequence:CCGGCGATGCAATGAGTGTGGGAAACTCGAGTTTCCCACACTCATTGCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033288.3-538s21c1
Sequence:CCGGGAACGCCGGAATGTGTCAAAGCTCGAGCTTTGACACATTCCGGCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033288.3-1185s21c1
Sequence:CCGGGTTCGTTCAAATCTAACTATTCTCGAGAATAGTTAGATTTGAACGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033288.3-2009s21c1
Sequence:CCGGTGGTAAAGTCTTCGCTCAAACCTCGAGGTTTGAGCGAAGACTTTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434141    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033288.3-3097s21c1
Sequence:CCGGGAATACTCACAAGTCCAAATACTCGAGTATTTGGACTTGTGAGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks