EMAIL THIS PAGE TO A FRIEND

ZNF165

zinc finger protein 165

Synonyms: CT53 LD65 ZSCAN7
UniProtKB ID: P49910
Gene ID:
Human(7718) Summary: This gene encodes a member of the Kruppel family of zinc finger proteins. Members of this DNA-binding protein family act as transcriptional regulators. This gene is located within a cluster of zinc finger family members. The encoded protein may play a role in spermatogenesis. [provided by RefSeq, Jul 2008]
cow(506398) zinc finger protein 165
sheep(101122141) zinc finger protein 165
Horse(100062165) zinc finger protein 165
domestic cat(101088841) zinc finger protein 165
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003447 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003447 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003447 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144021 MISSION® esiRNA esiRNA human ZNF165 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003447 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003447 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00226569 predicted 1770
2 SASI_Hs01_00226570 predicted 2306
3 SASI_Hs01_00226572 predicted 2272
4 SASI_Hs01_00226573 predicted 1687
5 SASI_Hs02_00335677 predicted 1772
6 SASI_Hs01_00226574 predicted 1940
7 SASI_Hs01_00226575 predicted 1962
8 SASI_Hs01_00226576 predicted 1466
9 SASI_Hs01_00226577 predicted 1485
10 SASI_Hs02_00335678 predicted 1689
11 SASI_Hs01_00226571 predicted 2320
12 SASI_Hs01_00226578 predicted 2321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003447
ZNF165 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 165
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003447.2-2406s1c1
Sequence:CCGGCACATCTTATTCGACACTTTACTCGAGTAAAGTGTCGAATAAGATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003447.2-2306s1c1
Sequence:CCGGGCATTCAACCTGAACTCACATCTCGAGATGTGAGTTCAGGTTGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003447.2-1157s1c1
Sequence:CCGGGAAGAGGAAGAATTTATCCATCTCGAGATGGATAAATTCTTCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003447.2-1442s1c1
Sequence:CCGGGCAGTGACCATACTAGAAGATCTCGAGATCTTCTAGTATGGTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003447.2-1553s1c1
Sequence:CCGGCCAGCACTTAATGTCAAGTTACTCGAGTAACTTGACATTAAGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003447
ZNF165 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 165
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003447.2-2406s1c1
Sequence:CCGGCACATCTTATTCGACACTTTACTCGAGTAAAGTGTCGAATAAGATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003447.2-2306s1c1
Sequence:CCGGGCATTCAACCTGAACTCACATCTCGAGATGTGAGTTCAGGTTGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003447.2-1157s1c1
Sequence:CCGGGAAGAGGAAGAATTTATCCATCTCGAGATGGATAAATTCTTCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003447.2-1442s1c1
Sequence:CCGGGCAGTGACCATACTAGAAGATCTCGAGATCTTCTAGTATGGTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003447.2-1553s1c1
Sequence:CCGGCCAGCACTTAATGTCAAGTTACTCGAGTAACTTGACATTAAGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003447
ZNF165 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 165
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003447.2-2406s1c1
Sequence:CCGGCACATCTTATTCGACACTTTACTCGAGTAAAGTGTCGAATAAGATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003447.2-2306s1c1
Sequence:CCGGGCATTCAACCTGAACTCACATCTCGAGATGTGAGTTCAGGTTGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003447.2-1157s1c1
Sequence:CCGGGAAGAGGAAGAATTTATCCATCTCGAGATGGATAAATTCTTCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003447.2-1442s1c1
Sequence:CCGGGCAGTGACCATACTAGAAGATCTCGAGATCTTCTAGTATGGTCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003447.2-1553s1c1
Sequence:CCGGCCAGCACTTAATGTCAAGTTACTCGAGTAACTTGACATTAAGTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks