EMAIL THIS PAGE TO A FRIEND

ZNF169

zinc finger protein 169

UniProtKB ID: Q14929, A2AGP5, A8K127, Q6PI28
Gene ID:
cow(531355) zinc finger protein 169
sheep(101110308) zinc finger protein 169
domestic cat(101084396) zinc finger protein 169
Horse(100059949) zinc finger protein 169
dog(484204) zinc finger protein 169
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194320 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194320 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194320 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194320 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023813 predicted 340
2 SASI_Hs02_00371460 predicted 454
3 SASI_Hs01_00023814 predicted 1305
4 SASI_Hs01_00023815 predicted 1483
5 SASI_Hs01_00023816 predicted 504
6 SASI_Hs01_00023817 predicted 1564
7 SASI_Hs01_00023818 predicted 1000
8 SASI_Hs01_00023820 predicted 584
9 SASI_Hs01_00023821 predicted 1679
10 SASI_Hs01_00023822 predicted 1585
11 SASI_Hs01_00023819 predicted 1467
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194320
ZNF169 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 169
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194320.1-570s1c1
Sequence:CCGGGACCCAGTAGAATGGGTAGAACTCGAGTTCTACCCATTCTACTGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194320.1-1639s1c1
Sequence:CCGGCACACCTTATCTCTGACCAAACTCGAGTTTGGTCAGAGATAAGGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194320.1-1041s1c1
Sequence:CCGGCGCCAGAAGATAGCCCTCCTTCTCGAGAAGGAGGGCTATCTTCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194320.1-511s1c1
Sequence:CCGGGCTCATTAAGAAAGAGGCCAACTCGAGTTGGCCTCTTTCTTAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194320.1-1798s1c1
Sequence:CCGGGCCAGAAGTCTCACTTGCATACTCGAGTATGCAAGTGAGACTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194320.2-1725s21c1
Sequence:CCGGGCCCTGCATTTGCGATGAATGCTCGAGCATTCATCGCAAATGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194320.2-2018s21c1
Sequence:CCGGCGATCATGAGATAGTTGATTTCTCGAGAAATCAACTATCTCATGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194320
ZNF169 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 169
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194320.1-570s1c1
Sequence:CCGGGACCCAGTAGAATGGGTAGAACTCGAGTTCTACCCATTCTACTGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194320.1-1639s1c1
Sequence:CCGGCACACCTTATCTCTGACCAAACTCGAGTTTGGTCAGAGATAAGGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194320.1-1041s1c1
Sequence:CCGGCGCCAGAAGATAGCCCTCCTTCTCGAGAAGGAGGGCTATCTTCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194320.1-511s1c1
Sequence:CCGGGCTCATTAAGAAAGAGGCCAACTCGAGTTGGCCTCTTTCTTAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194320.1-1798s1c1
Sequence:CCGGGCCAGAAGTCTCACTTGCATACTCGAGTATGCAAGTGAGACTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194320.2-1725s21c1
Sequence:CCGGGCCCTGCATTTGCGATGAATGCTCGAGCATTCATCGCAAATGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194320.2-2018s21c1
Sequence:CCGGCGATCATGAGATAGTTGATTTCTCGAGAAATCAACTATCTCATGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194320
ZNF169 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 169
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194320.1-570s1c1
Sequence:CCGGGACCCAGTAGAATGGGTAGAACTCGAGTTCTACCCATTCTACTGGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194320.1-1639s1c1
Sequence:CCGGCACACCTTATCTCTGACCAAACTCGAGTTTGGTCAGAGATAAGGTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194320.1-1041s1c1
Sequence:CCGGCGCCAGAAGATAGCCCTCCTTCTCGAGAAGGAGGGCTATCTTCTGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194320.1-511s1c1
Sequence:CCGGGCTCATTAAGAAAGAGGCCAACTCGAGTTGGCCTCTTTCTTAATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194320.1-1798s1c1
Sequence:CCGGGCCAGAAGTCTCACTTGCATACTCGAGTATGCAAGTGAGACTTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194320.2-1725s21c1
Sequence:CCGGGCCCTGCATTTGCGATGAATGCTCGAGCATTCATCGCAAATGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194320.2-2018s21c1
Sequence:CCGGCGATCATGAGATAGTTGATTTCTCGAGAAATCAACTATCTCATGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks