EMAIL THIS PAGE TO A FRIEND

ZNF16

zinc finger protein 16

Synonyms: HZF1 KOX9
UniProtKB ID: P17020, B3KXM4, D3DWP2, Q96FG0
Gene ID:
Human(7564) Summary: The protein encoded by this gene contains multiple tandem zinc finger motifs. The encoded protein is involved in the differentiation of erythroid and megakaryocytic cells. This gene is located in a cluster of related genes on chromosome 8 encoding zinc finger proteins. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
cow(100294758) zinc finger protein 16
sheep(101105510) zinc finger protein 16
domestic guinea pig(100718914) zinc finger protein 16
naked mole-rat(101701424) zinc finger protein 16
dog(100686789) zinc finger protein 16
domestic cat(101083655) zinc finger protein 16
36 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006958 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006958 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006958 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119301 MISSION® esiRNA esiRNA human ZNF16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029976 Rosetta Predictions human pricing
NM_006958 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029976 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146712 predicted 1912
2 SASI_Hs01_00146714 predicted 2264
3 SASI_Hs01_00146716 predicted 1609
4 SASI_Hs01_00146718 predicted 2251
5 SASI_Hs01_00146719 predicted 2154
6 SASI_Hs02_00307581 predicted 836
7 SASI_Hs01_00146720 predicted 892
8 SASI_Hs01_00146721 predicted 2189
9 SASI_Hs02_00307582 predicted 792
10 SASI_Hs02_00307583 predicted 890
11 SASI_Hs01_00146713 predicted 1180
12 SASI_Hs01_00146715 predicted 595
13 SASI_Hs01_00146717 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028185 predicted 1835
2 SASI_Hs01_00028187 predicted 2174
3 SASI_Hs01_00028189 predicted 1529
4 SASI_Hs01_00028191 predicted 2164
5 SASI_Hs01_00028192 predicted 2061
6 SASI_Hs02_00342693 predicted 755
7 SASI_Hs01_00028193 predicted 799
8 SASI_Hs01_00028194 predicted 2103
9 SASI_Hs02_00342694 predicted 713
10 SASI_Hs02_00342695 predicted 802
11 SASI_Hs01_00028186 predicted 1095
12 SASI_Hs01_00028188 predicted 503
13 SASI_Hs01_00028190 predicted 348
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006958
VALIDATED
ZNF16 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 16
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006958.2-768s21c1
Sequence:CCGGGACCTTATTCAGCGTCAAATACTCGAGTATTTGACGCTGAATAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006958.2-1842s21c1
Sequence:CCGGGCCTTCAACCGAAGCTCAAATCTCGAGATTTGAGCTTCGGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006958.2-2293s21c1
Sequence:CCGGCCTCCTTTGAAACATCCTTTACTCGAGTAAAGGATGTTTCAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006958.2-1346s21c1
Sequence:CCGGTCGGGTCTCCAACCTCATTAACTCGAGTTAATGAGGTTGGAGACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006958.2-963s21c1
Sequence:CCGGAGCAGTGAGAGGCCTTATATGCTCGAGCATATAAGGCCTCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006958.2-2292s1c1
Sequence:CCGGCCCTCCTTTGAAACATCCTTTCTCGAGAAAGGATGTTTCAAAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006958.2-804s1c1
Sequence:CCGGGCTTCCTTTATGTGTGATGATCTCGAGATCATCACACATAAAGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006958.2-2102s1c1
Sequence:CCGGCCAGCGATCAAAGTTGATCAACTCGAGTTGATCAACTTTGATCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006958.2-765s1c1
Sequence:CCGGCCTGACCTTATTCAGCGTCAACTCGAGTTGACGCTGAATAAGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006958.2-1847s1c1
Sequence:CCGGCAACCGAAGCTCAAATCTCATCTCGAGATGAGATTTGAGCTTCGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006958
VALIDATED
ZNF16 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 16
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006958.2-768s21c1
Sequence:CCGGGACCTTATTCAGCGTCAAATACTCGAGTATTTGACGCTGAATAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006958.2-1842s21c1
Sequence:CCGGGCCTTCAACCGAAGCTCAAATCTCGAGATTTGAGCTTCGGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006958.2-2293s21c1
Sequence:CCGGCCTCCTTTGAAACATCCTTTACTCGAGTAAAGGATGTTTCAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006958.2-1346s21c1
Sequence:CCGGTCGGGTCTCCAACCTCATTAACTCGAGTTAATGAGGTTGGAGACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006958.2-963s21c1
Sequence:CCGGAGCAGTGAGAGGCCTTATATGCTCGAGCATATAAGGCCTCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006958.2-2292s1c1
Sequence:CCGGCCCTCCTTTGAAACATCCTTTCTCGAGAAAGGATGTTTCAAAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006958.2-804s1c1
Sequence:CCGGGCTTCCTTTATGTGTGATGATCTCGAGATCATCACACATAAAGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006958.2-2102s1c1
Sequence:CCGGCCAGCGATCAAAGTTGATCAACTCGAGTTGATCAACTTTGATCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006958.2-765s1c1
Sequence:CCGGCCTGACCTTATTCAGCGTCAACTCGAGTTGACGCTGAATAAGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006958.2-1847s1c1
Sequence:CCGGCAACCGAAGCTCAAATCTCATCTCGAGATGAGATTTGAGCTTCGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006958
VALIDATED
ZNF16 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 16
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006958.2-768s21c1
Sequence:CCGGGACCTTATTCAGCGTCAAATACTCGAGTATTTGACGCTGAATAAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006958.2-1842s21c1
Sequence:CCGGGCCTTCAACCGAAGCTCAAATCTCGAGATTTGAGCTTCGGTTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232165    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006958.2-2293s21c1
Sequence:CCGGCCTCCTTTGAAACATCCTTTACTCGAGTAAAGGATGTTTCAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006958.2-1346s21c1
Sequence:CCGGTCGGGTCTCCAACCTCATTAACTCGAGTTAATGAGGTTGGAGACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006958.2-963s21c1
Sequence:CCGGAGCAGTGAGAGGCCTTATATGCTCGAGCATATAAGGCCTCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006958.2-2292s1c1
Sequence:CCGGCCCTCCTTTGAAACATCCTTTCTCGAGAAAGGATGTTTCAAAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006958.2-804s1c1
Sequence:CCGGGCTTCCTTTATGTGTGATGATCTCGAGATCATCACACATAAAGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006958.2-2102s1c1
Sequence:CCGGCCAGCGATCAAAGTTGATCAACTCGAGTTGATCAACTTTGATCGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006958.2-765s1c1
Sequence:CCGGCCTGACCTTATTCAGCGTCAACTCGAGTTGACGCTGAATAAGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006958.2-1847s1c1
Sequence:CCGGCAACCGAAGCTCAAATCTCATCTCGAGATGAGATTTGAGCTTCGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks