EMAIL THIS PAGE TO A FRIEND

ZNF174

zinc finger protein 174

Synonyms: ZSCAN8
UniProtKB ID: Q15697, Q53Y68, Q9BQ34
Gene ID:
cow(512411) zinc finger protein 174
sheep(101119780) zinc finger protein 174
naked mole-rat(101704655) zinc finger protein 174
domestic guinea pig(100714521) zinc finger protein 174
dog(490035) zinc finger protein 174
Horse(100065943) zinc finger protein 174
domestic cat(101097446) zinc finger protein 174
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003450 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU072941 MISSION® esiRNA esiRNA human ZNF174 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032292 Rosetta Predictions human pricing
NM_003450 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235246 predicted 1128
2 SASI_Hs01_00235247 predicted 810
3 SASI_Hs01_00235248 predicted 803
4 SASI_Hs01_00235249 predicted 968
5 SASI_Hs01_00235250 predicted 1130
6 SASI_Hs01_00235251 predicted 814
7 SASI_Hs01_00235252 predicted 1095
8 SASI_Hs01_00235253 predicted 1094
9 SASI_Hs02_00307877 predicted 808
10 SASI_Hs01_00235255 predicted 783
11 SASI_Hs01_00235254 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215667 predicted 948
2 SASI_Hs01_00215668 predicted 641
3 SASI_Hs01_00215669 predicted 631
4 SASI_Hs01_00215670 predicted 792
5 SASI_Hs01_00215671 predicted 958
6 SASI_Hs01_00215672 predicted 641
7 SASI_Hs01_00215673 predicted 920
8 SASI_Hs01_00215674 predicted 923
9 SASI_Hs02_00335681 predicted 635
10 SASI_Hs01_00215676 predicted 610
11 SASI_Hs01_00215675 predicted 624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003450
VALIDATED
ZNF174 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 174
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003450.1-2050s1c1
Sequence:CCGGGCAGAGAGCAAGGAGTAACTACTCGAGTAGTTACTCCTTGCTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003450.1-1542s1c1
Sequence:CCGGCCGCTCAGCAAAGAAACCCTACTCGAGTAGGGTTTCTTTGCTGAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003450.1-634s1c1
Sequence:CCGGTCCAAGCAAGAGAGACACATACTCGAGTATGTGTCTCTCTTGCTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003450.1-1462s1c1
Sequence:CCGGCCACTGAGAGAGCTAAAGAAACTCGAGTTTCTTTAGCTCTCTCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003450.1-960s1c1
Sequence:CCGGCAGAGCATCCAAGAAACCAAACTCGAGTTTGGTTTCTTGGATGCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003450.2-1190s21c1
Sequence:CCGGCAGAGCATCCAAGAAACCAAACTCGAGTTTGGTTTCTTGGATGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003450.2-2060s21c1
Sequence:CCGGGATTCACACGGAAGGTGTTTGCTCGAGCAAACACCTTCCGTGTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003450.2-1737s21c1
Sequence:CCGGAGCAACCGTTTGCAACATCTTCTCGAGAAGATGTTGCAAACGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003450.2-1573s21c1
Sequence:CCGGATATGAGTGAACCTCGGTTGTCTCGAGACAACCGAGGTTCACTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003450.2-1647s21c1
Sequence:CCGGAGACATTGCAGGGTGGAATACCTCGAGGTATTCCACCCTGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003450
VALIDATED
ZNF174 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 174
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003450.1-2050s1c1
Sequence:CCGGGCAGAGAGCAAGGAGTAACTACTCGAGTAGTTACTCCTTGCTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003450.1-1542s1c1
Sequence:CCGGCCGCTCAGCAAAGAAACCCTACTCGAGTAGGGTTTCTTTGCTGAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003450.1-634s1c1
Sequence:CCGGTCCAAGCAAGAGAGACACATACTCGAGTATGTGTCTCTCTTGCTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003450.1-1462s1c1
Sequence:CCGGCCACTGAGAGAGCTAAAGAAACTCGAGTTTCTTTAGCTCTCTCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003450.1-960s1c1
Sequence:CCGGCAGAGCATCCAAGAAACCAAACTCGAGTTTGGTTTCTTGGATGCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003450.2-1190s21c1
Sequence:CCGGCAGAGCATCCAAGAAACCAAACTCGAGTTTGGTTTCTTGGATGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003450.2-2060s21c1
Sequence:CCGGGATTCACACGGAAGGTGTTTGCTCGAGCAAACACCTTCCGTGTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003450.2-1737s21c1
Sequence:CCGGAGCAACCGTTTGCAACATCTTCTCGAGAAGATGTTGCAAACGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003450.2-1573s21c1
Sequence:CCGGATATGAGTGAACCTCGGTTGTCTCGAGACAACCGAGGTTCACTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003450.2-1647s21c1
Sequence:CCGGAGACATTGCAGGGTGGAATACCTCGAGGTATTCCACCCTGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003450
VALIDATED
ZNF174 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 174
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003450.1-2050s1c1
Sequence:CCGGGCAGAGAGCAAGGAGTAACTACTCGAGTAGTTACTCCTTGCTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003450.1-1542s1c1
Sequence:CCGGCCGCTCAGCAAAGAAACCCTACTCGAGTAGGGTTTCTTTGCTGAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003450.1-634s1c1
Sequence:CCGGTCCAAGCAAGAGAGACACATACTCGAGTATGTGTCTCTCTTGCTTGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003450.1-1462s1c1
Sequence:CCGGCCACTGAGAGAGCTAAAGAAACTCGAGTTTCTTTAGCTCTCTCAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003450.1-960s1c1
Sequence:CCGGCAGAGCATCCAAGAAACCAAACTCGAGTTTGGTTTCTTGGATGCTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_003450.2-1190s21c1
Sequence:CCGGCAGAGCATCCAAGAAACCAAACTCGAGTTTGGTTTCTTGGATGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274239    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_003450.2-2060s21c1
Sequence:CCGGGATTCACACGGAAGGTGTTTGCTCGAGCAAACACCTTCCGTGTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003450.2-1737s21c1
Sequence:CCGGAGCAACCGTTTGCAACATCTTCTCGAGAAGATGTTGCAAACGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003450.2-1573s21c1
Sequence:CCGGATATGAGTGAACCTCGGTTGTCTCGAGACAACCGAGGTTCACTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003450.2-1647s21c1
Sequence:CCGGAGACATTGCAGGGTGGAATACCTCGAGGTATTCCACCCTGCAATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks