EMAIL THIS PAGE TO A FRIEND

ZNF175

zinc finger protein 175

Synonyms: OTK18
UniProtKB ID: Q9Y473, A8K9H2
Gene ID:
Horse(100147677) zinc finger protein 175
domestic cat(101094466) zinc finger protein 175
cow(537103) zinc finger protein 175
sheep(101123658) zinc finger protein 175
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007147 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007147 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007147 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122531 MISSION® esiRNA esiRNA human ZNF175 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007147 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007147 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343046 predicted 433
2 SASI_Hs01_00220057 predicted 1062
3 SASI_Hs01_00220058 predicted 2297
4 SASI_Hs01_00220059 predicted 1172
5 SASI_Hs01_00220060 predicted 1364
6 SASI_Hs01_00220061 predicted 729
7 SASI_Hs01_00220062 predicted 1154
8 SASI_Hs02_00343047 predicted 1131
9 SASI_Hs01_00220064 predicted 1828
10 SASI_Hs01_00220065 predicted 1791
11 SASI_Hs01_00220056 predicted 2492
12 SASI_Hs01_00220063 predicted 2418
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007147
VALIDATED
ZNF175 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 175
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007147.2-1057s21c1
Sequence:CCGGGTTGGGTCTGGTCAGCTATTCCTCGAGGAATAGCTGACCAGACCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007147.2-1093s21c1
Sequence:CCGGGATGCCTGCAGCAAGAATATTCTCGAGAATATTCTTGCTGCAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007147.2-1358s21c1
Sequence:CCGGCAGATCATACAGGTGATATACCTCGAGGTATATCACCTGTATGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007147.2-1175s21c1
Sequence:GTACCGGCACTCAAGCAACATCAAATTCCTCGAGGAATTTGATGTTGCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007147.2-2826s21c1
Sequence:CCGGACAGGTTGTTACTCGATTATTCTCGAGAATAATCGAGTAACAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007147.2-3130s1c1
Sequence:CCGGCCAAGATTAAATGCTCCAATTCTCGAGAATTGGAGCATTTAATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007147.2-594s1c1
Sequence:CCGGCCCAGAGGTCATCTTCAGAATCTCGAGATTCTGAAGATGACCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_007147.2-1002s1c1
Sequence:CCGGCCTAGAAGTGAACGGTCAGAACTCGAGTTCTGACCGTTCACTTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_007147.2-1756s1c1
Sequence:CCGGGCACACCTGATTGTCCATCAACTCGAGTTGATGGACAATCAGGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_007147.2-2078s1c1
Sequence:CCGGCCTTCACTTCTAAGTCTCAATCTCGAGATTGAGACTTAGAAGTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007147
VALIDATED
ZNF175 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 175
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007147.2-1057s21c1
Sequence:CCGGGTTGGGTCTGGTCAGCTATTCCTCGAGGAATAGCTGACCAGACCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007147.2-1093s21c1
Sequence:CCGGGATGCCTGCAGCAAGAATATTCTCGAGAATATTCTTGCTGCAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007147.2-1358s21c1
Sequence:CCGGCAGATCATACAGGTGATATACCTCGAGGTATATCACCTGTATGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007147.2-1175s21c1
Sequence:GTACCGGCACTCAAGCAACATCAAATTCCTCGAGGAATTTGATGTTGCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007147.2-2826s21c1
Sequence:CCGGACAGGTTGTTACTCGATTATTCTCGAGAATAATCGAGTAACAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007147.2-3130s1c1
Sequence:CCGGCCAAGATTAAATGCTCCAATTCTCGAGAATTGGAGCATTTAATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007147.2-594s1c1
Sequence:CCGGCCCAGAGGTCATCTTCAGAATCTCGAGATTCTGAAGATGACCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_007147.2-1002s1c1
Sequence:CCGGCCTAGAAGTGAACGGTCAGAACTCGAGTTCTGACCGTTCACTTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_007147.2-1756s1c1
Sequence:CCGGGCACACCTGATTGTCCATCAACTCGAGTTGATGGACAATCAGGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_007147.2-2078s1c1
Sequence:CCGGCCTTCACTTCTAAGTCTCAATCTCGAGATTGAGACTTAGAAGTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007147
VALIDATED
ZNF175 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 175
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007147.2-1057s21c1
Sequence:CCGGGTTGGGTCTGGTCAGCTATTCCTCGAGGAATAGCTGACCAGACCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007147.2-1093s21c1
Sequence:CCGGGATGCCTGCAGCAAGAATATTCTCGAGAATATTCTTGCTGCAGGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007147.2-1358s21c1
Sequence:CCGGCAGATCATACAGGTGATATACCTCGAGGTATATCACCTGTATGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007147.2-1175s21c1
Sequence:GTACCGGCACTCAAGCAACATCAAATTCCTCGAGGAATTTGATGTTGCTTGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229689    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007147.2-2826s21c1
Sequence:CCGGACAGGTTGTTACTCGATTATTCTCGAGAATAATCGAGTAACAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012988    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007147.2-3130s1c1
Sequence:CCGGCCAAGATTAAATGCTCCAATTCTCGAGAATTGGAGCATTTAATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007147.2-594s1c1
Sequence:CCGGCCCAGAGGTCATCTTCAGAATCTCGAGATTCTGAAGATGACCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_007147.2-1002s1c1
Sequence:CCGGCCTAGAAGTGAACGGTCAGAACTCGAGTTCTGACCGTTCACTTCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A3
TRC Version: 1 Clone ID:NM_007147.2-1756s1c1
Sequence:CCGGGCACACCTGATTGTCCATCAACTCGAGTTGATGGACAATCAGGTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A3
TRC Version: 1 Clone ID:NM_007147.2-2078s1c1
Sequence:CCGGCCTTCACTTCTAAGTCTCAATCTCGAGATTGAGACTTAGAAGTGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks