EMAIL THIS PAGE TO A FRIEND

ZNF177

zinc finger protein 177

Synonyms: PIGX
UniProtKB ID: Q13360, B4DY57, E9PDG0, I3L0I4, Q96ER2
Gene ID:
cow(100124511) zinc finger protein 177
naked mole-rat(101726368) zinc finger protein 177
dog(484969) zinc finger protein 177
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003451 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003451 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003451 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030051 MISSION® esiRNA esiRNA human ZNF177 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003451 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060634 predicted 1486
2 SASI_Hs01_00060635 predicted 614
3 SASI_Hs01_00060636 predicted 902
4 SASI_Hs01_00060637 predicted 1368
5 SASI_Hs01_00060638 predicted 1267
6 SASI_Hs01_00060639 predicted 735
7 SASI_Hs01_00060640 predicted 782
8 SASI_Hs02_00335682 predicted 1349
9 SASI_Hs02_00335683 predicted 659
10 SASI_Hs02_00335684 predicted 705
11 SASI_Hs01_00060641 predicted 1462
12 SASI_Hs01_00060642 predicted 1206
13 SASI_Hs01_00060643 predicted 1460
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003451
ZNF177 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 177
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003451.1-1455s1c1
Sequence:CCGGGCCTCCTTTCTCACTTTAGAACTCGAGTTCTAAAGTGAGAAAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003451.1-1026s1c1
Sequence:CCGGTGTTCCTTCATCCCTTCAGAACTCGAGTTCTGAAGGGATGAAGGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003451.1-1368s1c1
Sequence:CCGGCACTAACCTTATAATGCACAACTCGAGTTGTGCATTATAAGGTTAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003451.1-483s1c1
Sequence:CCGGGTCACAGAACTCAGTAACCTTCTCGAGAAGGTTACTGAGTTCTGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003451.2-1592s21c1
Sequence:CCGGCAGTGAGTATTTCATTCTTATCTCGAGATAAGAATGAAATACTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003451.1-1623s21c1
Sequence:CCGGACTGTAGATCCTATGAATATTCTCGAGAATATTCATAGGATCTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003451.1-740s21c1
Sequence:CCGGCAATTGCTATGCAGAACATTCCTCGAGGAATGTTCTGCATAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003451
ZNF177 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 177
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003451.1-1455s1c1
Sequence:CCGGGCCTCCTTTCTCACTTTAGAACTCGAGTTCTAAAGTGAGAAAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003451.1-1026s1c1
Sequence:CCGGTGTTCCTTCATCCCTTCAGAACTCGAGTTCTGAAGGGATGAAGGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003451.1-1368s1c1
Sequence:CCGGCACTAACCTTATAATGCACAACTCGAGTTGTGCATTATAAGGTTAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003451.1-483s1c1
Sequence:CCGGGTCACAGAACTCAGTAACCTTCTCGAGAAGGTTACTGAGTTCTGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003451.2-1592s21c1
Sequence:CCGGCAGTGAGTATTTCATTCTTATCTCGAGATAAGAATGAAATACTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003451.1-1623s21c1
Sequence:CCGGACTGTAGATCCTATGAATATTCTCGAGAATATTCATAGGATCTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003451.1-740s21c1
Sequence:CCGGCAATTGCTATGCAGAACATTCCTCGAGGAATGTTCTGCATAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003451
ZNF177 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 177
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012993    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003451.1-1455s1c1
Sequence:CCGGGCCTCCTTTCTCACTTTAGAACTCGAGTTCTAAAGTGAGAAAGGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012994    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003451.1-1026s1c1
Sequence:CCGGTGTTCCTTCATCCCTTCAGAACTCGAGTTCTGAAGGGATGAAGGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003451.1-1368s1c1
Sequence:CCGGCACTAACCTTATAATGCACAACTCGAGTTGTGCATTATAAGGTTAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003451.1-483s1c1
Sequence:CCGGGTCACAGAACTCAGTAACCTTCTCGAGAAGGTTACTGAGTTCTGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433873    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003451.2-1592s21c1
Sequence:CCGGCAGTGAGTATTTCATTCTTATCTCGAGATAAGAATGAAATACTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003451.1-1623s21c1
Sequence:CCGGACTGTAGATCCTATGAATATTCTCGAGAATATTCATAGGATCTACAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003451.1-740s21c1
Sequence:CCGGCAATTGCTATGCAGAACATTCCTCGAGGAATGTTCTGCATAGCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks