EMAIL THIS PAGE TO A FRIEND

ZNF17

zinc finger protein 17

Synonyms: HPF3 KOX10
UniProtKB ID: P17021, B3KXU2, B3KY20, Q8N7M1, Q8N893, Q8TF54
Gene ID:
Horse(100060116) zinc finger protein 17
cow(527186) zinc finger protein 17
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV36291 Anti-ZNF17 (AB1) antibody produced in rabbit affinity isolated antibody human
western blot pricing
AV38886 Anti-ZNF17 (AB2) antibody produced in rabbit affinity isolated antibody human, bovine, horse, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006959 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006959 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006959 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136171 MISSION® esiRNA esiRNA human ZNF17 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006959 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006959 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168629 predicted 891
2 SASI_Hs02_00342696 predicted 1839
3 SASI_Hs02_00342697 predicted 835
4 SASI_Hs02_00342698 predicted 1742
5 SASI_Hs02_00342699 predicted 1860
6 SASI_Hs01_00168632 predicted 1001
7 SASI_Hs01_00168633 predicted 558
8 SASI_Hs02_00342700 predicted 1965
9 SASI_Hs01_00168635 predicted 404
10 SASI_Hs01_00168636 predicted 1154
11 SASI_Hs01_00168630 predicted 895
12 SASI_Hs01_00168631 predicted 900
13 SASI_Hs01_00168634 predicted 708
14 SASI_Hs01_00168637 predicted 1241
15 SASI_Hs01_00168638 predicted 616
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006959
ZNF17 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 17
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006959.2-2421s21c1
Sequence:CCGGCTTATGAAACTAAGTCTATACCTCGAGGTATAGACTTAGTTTCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006959.2-2483s21c1
Sequence:CCGGAGCACCGCTCTGTATGAATTTCTCGAGAAATTCATACAGAGCGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006959.2-1755s21c1
Sequence:CCGGATGTCGCTCCACACTTGATACCTCGAGGTATCAAGTGTGGAGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006959.1-545s1c1
Sequence:CCGGCCAAGCTTTACCTGCACCAAACTCGAGTTTGGTGCAGGTAAAGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006959.1-1243s1c1
Sequence:CCGGGCACTCATTAGACATCAGAAACTCGAGTTTCTGATGTCTAATGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006959.1-909s1c1
Sequence:CCGGCCTTATTAAACATCAGCGAAACTCGAGTTTCGCTGATGTTTAATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006959.1-1405s1c1
Sequence:CCGGCGTTCCACACTCATTAGACATCTCGAGATGTCTAATGAGTGTGGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006959.1-2084s1c1
Sequence:CCGGGCCTCATTAAACATCGGAGAACTCGAGTTCTCCGATGTTTAATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006959
ZNF17 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 17
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006959.2-2421s21c1
Sequence:CCGGCTTATGAAACTAAGTCTATACCTCGAGGTATAGACTTAGTTTCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006959.2-2483s21c1
Sequence:CCGGAGCACCGCTCTGTATGAATTTCTCGAGAAATTCATACAGAGCGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006959.2-1755s21c1
Sequence:CCGGATGTCGCTCCACACTTGATACCTCGAGGTATCAAGTGTGGAGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006959.1-545s1c1
Sequence:CCGGCCAAGCTTTACCTGCACCAAACTCGAGTTTGGTGCAGGTAAAGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006959.1-1243s1c1
Sequence:CCGGGCACTCATTAGACATCAGAAACTCGAGTTTCTGATGTCTAATGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006959.1-909s1c1
Sequence:CCGGCCTTATTAAACATCAGCGAAACTCGAGTTTCGCTGATGTTTAATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006959.1-1405s1c1
Sequence:CCGGCGTTCCACACTCATTAGACATCTCGAGATGTCTAATGAGTGTGGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006959.1-2084s1c1
Sequence:CCGGGCCTCATTAAACATCGGAGAACTCGAGTTCTCCGATGTTTAATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006959
ZNF17 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 17
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434622    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006959.2-2421s21c1
Sequence:CCGGCTTATGAAACTAAGTCTATACCTCGAGGTATAGACTTAGTTTCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431905    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006959.2-2483s21c1
Sequence:CCGGAGCACCGCTCTGTATGAATTTCTCGAGAAATTCATACAGAGCGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006959.2-1755s21c1
Sequence:CCGGATGTCGCTCCACACTTGATACCTCGAGGTATCAAGTGTGGAGCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006959.1-545s1c1
Sequence:CCGGCCAAGCTTTACCTGCACCAAACTCGAGTTTGGTGCAGGTAAAGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006959.1-1243s1c1
Sequence:CCGGGCACTCATTAGACATCAGAAACTCGAGTTTCTGATGTCTAATGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006959.1-909s1c1
Sequence:CCGGCCTTATTAAACATCAGCGAAACTCGAGTTTCGCTGATGTTTAATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006959.1-1405s1c1
Sequence:CCGGCGTTCCACACTCATTAGACATCTCGAGATGTCTAATGAGTGTGGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006959.1-2084s1c1
Sequence:CCGGGCCTCATTAAACATCGGAGAACTCGAGTTCTCCGATGTTTAATGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks