EMAIL THIS PAGE TO A FRIEND

ZNF180

zinc finger protein 180

Synonyms: HHZ168
UniProtKB ID: Q9UJW8, B2RCN6, Q9P1U2
Gene ID:
Human(7733) Summary: Zinc finger proteins have been shown to interact with nucleic acids and to have diverse functions. The zinc finger domain is a conserved amino acid sequence motif containing 2 specifically positioned cysteines and 2 histidines that are involved in coordinating zinc. Kruppel-related proteins form 1 family of zinc finger proteins. See MIM 604749 for additional information on zinc finger proteins.[supplied by OMIM, Jul 2002]
cow(514023) zinc finger protein 180
sheep(101109904) zinc finger protein 180
naked mole-rat(101729351) zinc finger protein 180
dog(100685461) zinc finger protein 180
Horse(100070558) zinc finger protein 180
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013256 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013256 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013256 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU002321 MISSION® esiRNA esiRNA targeting human ZNF180 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013256 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013256 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153205 predicted 944
2 SASI_Hs01_00153206 predicted 967
3 SASI_Hs01_00153207 predicted 1939
4 SASI_Hs01_00153208 predicted 1517
5 SASI_Hs01_00153209 predicted 2395
6 SASI_Hs02_00344473 predicted 844
7 SASI_Hs01_00153211 predicted 1200
8 SASI_Hs02_00344474 predicted 618
9 SASI_Hs01_00153212 predicted 664
10 SASI_Hs01_00153213 predicted 1237
11 SASI_Hs01_00153210 predicted 1677
12 SASI_Hs01_00153214 predicted 1290
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013256
ZNF180 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 180
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013256.1-2534s1c1
Sequence:CCGGCCTGGCAATTCCATATACAATCTCGAGATTGTATATGGAATTGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013256.1-1080s1c1
Sequence:CCGGCCTATGGATTTAGTGACCGTACTCGAGTACGGTCACTAAATCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013256.1-1942s1c1
Sequence:CCGGCCGCAGTTCTCACCTTGTTATCTCGAGATAACAAGGTGAGAACTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013256.1-889s1c1
Sequence:CCGGCCCAGTTATACCCATAAGAAACTCGAGTTTCTTATGGGTATAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013256.1-2201s1c1
Sequence:CCGGGCTCGACTTATTGTGCATCAACTCGAGTTGATGCACAATAAGTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013256.3-1045s21c1
Sequence:CCGGCCTCAGAGCATTCACCTTATTCTCGAGAATAAGGTGAATGCTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013256.3-1548s21c1
Sequence:CCGGTGTCCTTGTTGTGCATCAAAGCTCGAGCTTTGATGCACAACAAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013256.3-1099s21c1
Sequence:CCGGTATGGATTTAGTGACCGTATTCTCGAGAATACGGTCACTAAATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013256
ZNF180 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 180
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013256.1-2534s1c1
Sequence:CCGGCCTGGCAATTCCATATACAATCTCGAGATTGTATATGGAATTGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013256.1-1080s1c1
Sequence:CCGGCCTATGGATTTAGTGACCGTACTCGAGTACGGTCACTAAATCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013256.1-1942s1c1
Sequence:CCGGCCGCAGTTCTCACCTTGTTATCTCGAGATAACAAGGTGAGAACTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013256.1-889s1c1
Sequence:CCGGCCCAGTTATACCCATAAGAAACTCGAGTTTCTTATGGGTATAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013256.1-2201s1c1
Sequence:CCGGGCTCGACTTATTGTGCATCAACTCGAGTTGATGCACAATAAGTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013256.3-1045s21c1
Sequence:CCGGCCTCAGAGCATTCACCTTATTCTCGAGAATAAGGTGAATGCTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013256.3-1548s21c1
Sequence:CCGGTGTCCTTGTTGTGCATCAAAGCTCGAGCTTTGATGCACAACAAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013256.3-1099s21c1
Sequence:CCGGTATGGATTTAGTGACCGTATTCTCGAGAATACGGTCACTAAATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013256
ZNF180 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 180
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012998    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013256.1-2534s1c1
Sequence:CCGGCCTGGCAATTCCATATACAATCTCGAGATTGTATATGGAATTGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013256.1-1080s1c1
Sequence:CCGGCCTATGGATTTAGTGACCGTACTCGAGTACGGTCACTAAATCCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013256.1-1942s1c1
Sequence:CCGGCCGCAGTTCTCACCTTGTTATCTCGAGATAACAAGGTGAGAACTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013256.1-889s1c1
Sequence:CCGGCCCAGTTATACCCATAAGAAACTCGAGTTTCTTATGGGTATAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013256.1-2201s1c1
Sequence:CCGGGCTCGACTTATTGTGCATCAACTCGAGTTGATGCACAATAAGTCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013256.3-1045s21c1
Sequence:CCGGCCTCAGAGCATTCACCTTATTCTCGAGAATAAGGTGAATGCTCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013256.3-1548s21c1
Sequence:CCGGTGTCCTTGTTGTGCATCAAAGCTCGAGCTTTGATGCACAACAAGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013256.3-1099s21c1
Sequence:CCGGTATGGATTTAGTGACCGTATTCTCGAGAATACGGTCACTAAATCCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks