EMAIL THIS PAGE TO A FRIEND

ZNF181

zinc finger protein 181

Synonyms: HHZ181
UniProtKB ID: Q2M3W8, B7ZKX3, Q49A75
Gene ID:
Human(339318) Summary: Zinc finger proteins have been shown to interact with nucleic acids and to have diverse functions. The zinc finger domain is a conserved amino acid sequence motif containing 2 specifically positioned cysteines and 2 histidines that are involved in coordinating zinc. Kruppel-related proteins form 1 family of zinc finger proteins. See MIM 604749 for additional information on zinc finger proteins.[supplied by OMIM, Jul 2003]
Horse(100057907) zinc finger protein 181
domestic cat(101081591) zinc finger protein 181
dog(484590) zinc finger protein 181
naked mole-rat(101717478) zinc finger protein 181
Domestic Rabbit(100341153) zinc finger protein 181
cow(767826) zinc finger protein 181
sheep(101114378) zinc finger protein 181
35 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029997 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029997 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029997 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029997 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029997 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132591 predicted 1522
2 SASI_Hs02_00307597 predicted 2295
3 SASI_Hs02_00307598 predicted 2296
4 SASI_Hs01_00132597 predicted 2761
5 SASI_Hs02_00307599 predicted 1510
6 SASI_Hs02_00307600 predicted 1317
7 SASI_Hs02_00307601 predicted 2313
8 SASI_Hs02_00307602 predicted 2814
9 SASI_Hs01_00132592 predicted 2843
10 SASI_Hs02_00307603 predicted 2096
11 SASI_Hs01_00132589 predicted 2146
12 SASI_Hs01_00132590 predicted 2852
13 SASI_Hs01_00132593 predicted 2018
14 SASI_Hs01_00132594 predicted 2809
15 SASI_Hs01_00132595 predicted 1937
16 SASI_Hs01_00132596 predicted 2063
17 SASI_Hs01_00132598 predicted 1589
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029997
ZNF181 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 181
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000150266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029997.1-2822s1c1
Sequence:CCGGGCAGTGGTTATCATGGTAAATCTCGAGATTTACCATGATAACCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029997.1-2433s1c1
Sequence:CCGGCCAGCTTGAATCACTGAATATCTCGAGATATTCAGTGATTCAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029997.1-3303s1c1
Sequence:CCGGCCTGAAGGATTTAGGAGTTATCTCGAGATAACTCCTAAATCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029997.1-1788s1c1
Sequence:CCGGCCAGACTTGTAATAGAGAGAACTCGAGTTCTCTCTATTACAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029997.1-3416s1c1
Sequence:CCGGGCTTGCAGTTTCAGTTGAGTTCTCGAGAACTCAACTGAAACTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029997
ZNF181 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 181
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000150266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029997.1-2822s1c1
Sequence:CCGGGCAGTGGTTATCATGGTAAATCTCGAGATTTACCATGATAACCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029997.1-2433s1c1
Sequence:CCGGCCAGCTTGAATCACTGAATATCTCGAGATATTCAGTGATTCAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029997.1-3303s1c1
Sequence:CCGGCCTGAAGGATTTAGGAGTTATCTCGAGATAACTCCTAAATCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029997.1-1788s1c1
Sequence:CCGGCCAGACTTGTAATAGAGAGAACTCGAGTTCTCTCTATTACAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029997.1-3416s1c1
Sequence:CCGGGCTTGCAGTTTCAGTTGAGTTCTCGAGAACTCAACTGAAACTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029997
ZNF181 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 181
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000150266    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029997.1-2822s1c1
Sequence:CCGGGCAGTGGTTATCATGGTAAATCTCGAGATTTACCATGATAACCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029997.1-2433s1c1
Sequence:CCGGCCAGCTTGAATCACTGAATATCTCGAGATATTCAGTGATTCAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029997.1-3303s1c1
Sequence:CCGGCCTGAAGGATTTAGGAGTTATCTCGAGATAACTCCTAAATCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029997.1-1788s1c1
Sequence:CCGGCCAGACTTGTAATAGAGAGAACTCGAGTTCTCTCTATTACAAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149621    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029997.1-3416s1c1
Sequence:CCGGGCTTGCAGTTTCAGTTGAGTTCTCGAGAACTCAACTGAAACTGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks