EMAIL THIS PAGE TO A FRIEND

ZNF182

zinc finger protein 182

Synonyms: HHZ150 KOX14 ZNF21 Zfp182
UniProtKB ID: P17025, A2IDD7, Q3KP67, Q96QH7
Gene ID:
Human(7569) Summary: Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This gene encodes a zinc finger protein, and belongs to the krueppel C2H2-type zinc-finger protein family. It may be involved in transcriptional regulation. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, May 2010]
cow(530262) zinc finger protein 182
sheep(101115185) zinc finger protein 182
Domestic Rabbit(100353466) zinc finger protein 182
domestic guinea pig(100714903) zinc finger protein 182
dog(491864) zinc finger protein 182
domestic cat(101091090) zinc finger protein 182
Horse(100061541) zinc finger protein 182
34 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006962 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006962 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006962 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101301 MISSION® esiRNA esiRNA human ZNF182 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007088 Rosetta Predictions human pricing
NM_006962 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046638 predicted 568
2 SASI_Hs01_00046639 predicted 1570
3 SASI_Hs01_00046640 predicted 2194
4 SASI_Hs01_00046641 predicted 2167
5 SASI_Hs01_00046642 predicted 991
6 SASI_Hs01_00046643 predicted 1314
7 SASI_Hs01_00046644 predicted 954
8 SASI_Hs01_00046645 predicted 761
9 SASI_Hs01_00046647 predicted 2151
10 SASI_Hs02_00305216 predicted 1866
11 SASI_Hs01_00046646 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171029 predicted 657
2 SASI_Hs01_00171030 predicted 1667
3 SASI_Hs01_00171031 predicted 2287
4 SASI_Hs01_00171032 predicted 2266
5 SASI_Hs01_00171033 predicted 1082
6 SASI_Hs01_00171034 predicted 1404
7 SASI_Hs01_00171035 predicted 1046
8 SASI_Hs01_00171036 predicted 851
9 SASI_Hs01_00171038 predicted 2245
10 SASI_Hs02_00342702 predicted 1961
11 SASI_Hs01_00171037 predicted 1406
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006962
VALIDATED
ZNF182 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 182
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006962.1-2617s1c1
Sequence:CCGGCCATAGATATAACAGTGGTAACTCGAGTTACCACTGTTATATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006962.1-695s1c1
Sequence:CCGGCTGCTGATGCAAGTTGGATTTCTCGAGAAATCCAACTTGCATCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006962.1-815s1c1
Sequence:CCGGCCCGATAAACACGAATCATTTCTCGAGAAATGATTCGTGTTTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006962.1-800s1c1
Sequence:CCGGGCTTCAATACAAAGACCCGATCTCGAGATCGGGTCTTTGTATTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006962.1-2236s1c1
Sequence:CCGGCACTCGGAAGTCAAAGTTCATCTCGAGATGAACTTTGACTTCCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006962
VALIDATED
ZNF182 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 182
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006962.1-2617s1c1
Sequence:CCGGCCATAGATATAACAGTGGTAACTCGAGTTACCACTGTTATATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006962.1-695s1c1
Sequence:CCGGCTGCTGATGCAAGTTGGATTTCTCGAGAAATCCAACTTGCATCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006962.1-815s1c1
Sequence:CCGGCCCGATAAACACGAATCATTTCTCGAGAAATGATTCGTGTTTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006962.1-800s1c1
Sequence:CCGGGCTTCAATACAAAGACCCGATCTCGAGATCGGGTCTTTGTATTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006962.1-2236s1c1
Sequence:CCGGCACTCGGAAGTCAAAGTTCATCTCGAGATGAACTTTGACTTCCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006962
VALIDATED
ZNF182 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 182
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006962.1-2617s1c1
Sequence:CCGGCCATAGATATAACAGTGGTAACTCGAGTTACCACTGTTATATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006962.1-695s1c1
Sequence:CCGGCTGCTGATGCAAGTTGGATTTCTCGAGAAATCCAACTTGCATCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006962.1-815s1c1
Sequence:CCGGCCCGATAAACACGAATCATTTCTCGAGAAATGATTCGTGTTTATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006962.1-800s1c1
Sequence:CCGGGCTTCAATACAAAGACCCGATCTCGAGATCGGGTCTTTGTATTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006962.1-2236s1c1
Sequence:CCGGCACTCGGAAGTCAAAGTTCATCTCGAGATGAACTTTGACTTCCGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks