EMAIL THIS PAGE TO A FRIEND

ZNF184

zinc finger protein 184

UniProtKB ID: Q99676, B2R715, O60792, Q8TBA9
Gene ID:
dog(478746) zinc finger protein 184
domestic cat(101081381) zinc finger protein 184
Horse(100063674) zinc finger protein 184
domestic guinea pig(101788036) zinc finger protein 184
naked mole-rat(101709370) zinc finger protein 184
20 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003226 Anti-ZNF184 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007149 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007149 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007149 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU007661 MISSION® esiRNA esiRNA targeting human ZNF184 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007149 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007149 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028643 predicted 1263
2 SASI_Hs01_00028644 predicted 2317
3 SASI_Hs01_00028645 predicted 617
4 SASI_Hs01_00028646 predicted 1797
5 SASI_Hs02_00343053 predicted 680
6 SASI_Hs01_00028648 predicted 691
7 SASI_Hs01_00028649 predicted 2124
8 SASI_Hs02_00343054 predicted 1125
9 SASI_Hs01_00028650 predicted 2063
10 SASI_Hs02_00343055 predicted 1594
11 SASI_Hs01_00028647 predicted 837
12 SASI_Hs01_00028651 predicted 1717
13 SASI_Hs01_00028652 predicted 2122
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007149
ZNF184 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 184
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007149.1-2741s1c1
Sequence:CCGGCCTTTATGGAATGAAGGCTTTCTCGAGAAAGCCTTCATTCCATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007149.1-684s1c1
Sequence:CCGGCTTGCTAGAAAGTTGGGAATACTCGAGTATTCCCAACTTTCTAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007149.1-1887s1c1
Sequence:CCGGTCGGAGTTCATCTCTTGCTAACTCGAGTTAGCAAGAGATGAACTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007149.1-683s1c1
Sequence:CCGGACTTGCTAGAAAGTTGGGAATCTCGAGATTCCCAACTTTCTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007149.1-487s1c1
Sequence:CCGGCCTGATGTGATTTCCCAGTTACTCGAGTAACTGGGAAATCACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007149.2-2142s21c1
Sequence:CCGGTGGTAAAGCCTTTCGACATTGCTCGAGCAATGTCGAAAGGCTTTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007149.2-2032s21c1
Sequence:CCGGGAACGACCTTACAAGTGTAATCTCGAGATTACACTTGTAAGGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007149.2-1819s21c1
Sequence:CCGGAGTTATCTCTCAAACCTTAATCTCGAGATTAAGGTTTGAGAGATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007149.2-1988s21c1
Sequence:CCGGGTTATGGTTCATCCCTTATTCCTCGAGGAATAAGGGATGAACCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007149
ZNF184 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 184
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007149.1-2741s1c1
Sequence:CCGGCCTTTATGGAATGAAGGCTTTCTCGAGAAAGCCTTCATTCCATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007149.1-684s1c1
Sequence:CCGGCTTGCTAGAAAGTTGGGAATACTCGAGTATTCCCAACTTTCTAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007149.1-1887s1c1
Sequence:CCGGTCGGAGTTCATCTCTTGCTAACTCGAGTTAGCAAGAGATGAACTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007149.1-683s1c1
Sequence:CCGGACTTGCTAGAAAGTTGGGAATCTCGAGATTCCCAACTTTCTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007149.1-487s1c1
Sequence:CCGGCCTGATGTGATTTCCCAGTTACTCGAGTAACTGGGAAATCACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007149.2-2142s21c1
Sequence:CCGGTGGTAAAGCCTTTCGACATTGCTCGAGCAATGTCGAAAGGCTTTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007149.2-2032s21c1
Sequence:CCGGGAACGACCTTACAAGTGTAATCTCGAGATTACACTTGTAAGGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007149.2-1819s21c1
Sequence:CCGGAGTTATCTCTCAAACCTTAATCTCGAGATTAAGGTTTGAGAGATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007149.2-1988s21c1
Sequence:CCGGGTTATGGTTCATCCCTTATTCCTCGAGGAATAAGGGATGAACCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007149
ZNF184 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 184
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107995    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007149.1-2741s1c1
Sequence:CCGGCCTTTATGGAATGAAGGCTTTCTCGAGAAAGCCTTCATTCCATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007149.1-684s1c1
Sequence:CCGGCTTGCTAGAAAGTTGGGAATACTCGAGTATTCCCAACTTTCTAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007149.1-1887s1c1
Sequence:CCGGTCGGAGTTCATCTCTTGCTAACTCGAGTTAGCAAGAGATGAACTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007149.1-683s1c1
Sequence:CCGGACTTGCTAGAAAGTTGGGAATCTCGAGATTCCCAACTTTCTAGCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007149.1-487s1c1
Sequence:CCGGCCTGATGTGATTTCCCAGTTACTCGAGTAACTGGGAAATCACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007149.2-2142s21c1
Sequence:CCGGTGGTAAAGCCTTTCGACATTGCTCGAGCAATGTCGAAAGGCTTTACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007149.2-2032s21c1
Sequence:CCGGGAACGACCTTACAAGTGTAATCTCGAGATTACACTTGTAAGGTCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422758    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007149.2-1819s21c1
Sequence:CCGGAGTTATCTCTCAAACCTTAATCTCGAGATTAAGGTTTGAGAGATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007149.2-1988s21c1
Sequence:CCGGGTTATGGTTCATCCCTTATTCCTCGAGGAATAAGGGATGAACCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks