EMAIL THIS PAGE TO A FRIEND

ZNF185

zinc finger protein 185 (LIM domain)

Gene ID:
Human(7739) Summary: Zinc-finger proteins bind nucleic acids and play important roles in various cellular functions, including cell proliferation, differentiation, and apoptosis. This gene encodes a LIM-domain zinc finger protein. The LIM domain is composed of two contiguous zinc finger domains, separated by a two-amino acid residue hydrophobic linker. The LIM domain mediates protein:protein interactions. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, May 2010]
naked mole-rat(101717315) zinc finger protein 185 (LIM domain)
domestic guinea pig(100727994) zinc finger protein 185 (LIM domain)
cow(529754) zinc finger protein 185 (LIM domain)
sheep(101105140) zinc finger protein 185 (LIM domain)
Zebrafish(553349) zinc finger protein 185 (LIM domain)
chicken(422299) zinc finger protein 185 (LIM domain)
Horse(100063683) zinc finger protein 185 (LIM domain)
domestic cat(101096961) zinc finger protein 185 (LIM domain)
dog(492228) zinc finger protein 185 (LIM domain)
141 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007150 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007150 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007150 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU087901 MISSION® esiRNA esiRNA human ZNF185 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007150 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007150 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343056 predicted 1972
2 SASI_Hs02_00343057 predicted 783
3 SASI_Hs02_00343058 predicted 1035
4 SASI_Hs01_00182801 predicted 1729
5 SASI_Hs01_00182802 predicted 1943
6 SASI_Hs01_00182805 predicted 2054
7 SASI_Hs01_00182806 predicted 1920
8 SASI_Hs01_00182807 predicted 1406
9 SASI_Hs01_00182809 predicted 1808
10 SASI_Hs02_00343059 predicted 2010
11 SASI_Hs01_00182800 predicted 1246
12 SASI_Hs01_00182803 predicted 1644
13 SASI_Hs01_00182804 predicted 1644
14 SASI_Hs01_00182808 predicted 1575
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007150
VALIDATED
ZNF185 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 185 (LIM domain)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_007150.1-2311s1c1
Sequence:CCGGCCCATCTTAGACATGAGGATACTCGAGTATCCTCATGTCTAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007150.1-1244s1c1
Sequence:CCGGTGTCCAAAGATTACCCTAGAACTCGAGTTCTAGGGTAATCTTTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007150.1-475s1c1
Sequence:CCGGCCCTGCTGATAGGAAGAGCAACTCGAGTTGCTCTTCCTATCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_007150.1-1101s1c1
Sequence:CCGGAGCCAGTATCTGCACGCTATACTCGAGTATAGCGTGCAGATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007150.1-1247s1c1
Sequence:CCGGCCAAAGATTACCCTAGAACATCTCGAGATGTTCTAGGGTAATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007150
VALIDATED
ZNF185 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 185 (LIM domain)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_007150.1-2311s1c1
Sequence:CCGGCCCATCTTAGACATGAGGATACTCGAGTATCCTCATGTCTAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007150.1-1244s1c1
Sequence:CCGGTGTCCAAAGATTACCCTAGAACTCGAGTTCTAGGGTAATCTTTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007150.1-475s1c1
Sequence:CCGGCCCTGCTGATAGGAAGAGCAACTCGAGTTGCTCTTCCTATCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_007150.1-1101s1c1
Sequence:CCGGAGCCAGTATCTGCACGCTATACTCGAGTATAGCGTGCAGATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007150.1-1247s1c1
Sequence:CCGGCCAAAGATTACCCTAGAACATCTCGAGATGTTCTAGGGTAATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007150
VALIDATED
ZNF185 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 185 (LIM domain)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108020    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_007150.1-2311s1c1
Sequence:CCGGCCCATCTTAGACATGAGGATACTCGAGTATCCTCATGTCTAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_007150.1-1244s1c1
Sequence:CCGGTGTCCAAAGATTACCCTAGAACTCGAGTTCTAGGGTAATCTTTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007150.1-475s1c1
Sequence:CCGGCCCTGCTGATAGGAAGAGCAACTCGAGTTGCTCTTCCTATCAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_007150.1-1101s1c1
Sequence:CCGGAGCCAGTATCTGCACGCTATACTCGAGTATAGCGTGCAGATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108021    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_007150.1-1247s1c1
Sequence:CCGGCCAAAGATTACCCTAGAACATCTCGAGATGTTCTAGGGTAATCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks