EMAIL THIS PAGE TO A FRIEND

ZNF189

zinc finger protein 189

Gene ID:
Human(7743) Summary: Kruppel-like zinc finger proteins such as ZNF189 contain a conserved stretch of 7 amino acids that connects a variable number of DNA-binding zinc finger repeats of the cys(2)his(2) (C2H2) type (summarized by Odeberg et al., 1998 [PubMed 9653648]
Domestic Rabbit(100347109) zinc finger protein 189
naked mole-rat(101713934) zinc finger protein 189
domestic guinea pig(100720250) zinc finger protein 189
cow(540816) zinc finger protein 189
sheep(101121745) zinc finger protein 189
domestic cat(101096615) zinc finger protein 189
Horse(100054526) zinc finger protein 189
dog(474786) zinc finger protein 189
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1400301 Anti-ZNF189 antibody produced in mouse IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
HPA034814 Anti-ZNF189 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104078 Anti-ZNF189 antibody produced in rabbit affinity isolated antibody horse, rat, rabbit, guinea pig, zebrafish, bovine, mouse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003452 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU068721 MISSION® esiRNA esiRNA human ZNF189 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003452 Rosetta Predictions human pricing
NM_197977 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147532 predicted 2062
2 SASI_Hs01_00147533 predicted 2162
3 SASI_Hs02_00335685 predicted 831
4 SASI_Hs01_00147535 predicted 2051
5 SASI_Hs02_00335686 predicted 1405
6 SASI_Hs01_00147536 predicted 2193
7 SASI_Hs01_00147537 predicted 1718
8 SASI_Hs01_00147538 predicted 1255
9 SASI_Hs01_00147539 predicted 1544
10 SASI_Hs01_00147540 predicted 1834
11 SASI_Hs01_00147534 predicted 611
12 SASI_Hs01_00147541 predicted 2146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191854 predicted 2163
2 SASI_Hs01_00191855 predicted 2255
3 SASI_Hs02_00371592 predicted 931
4 SASI_Hs01_00191857 predicted 2152
5 SASI_Hs02_00371593 predicted 1502
6 SASI_Hs01_00191858 predicted 2281
7 SASI_Hs01_00191859 predicted 1809
8 SASI_Hs01_00191860 predicted 1346
9 SASI_Hs01_00191861 predicted 1641
10 SASI_Hs01_00191862 predicted 1922
11 SASI_Hs01_00191856 predicted 704
12 SASI_Hs01_00191863 predicted 2248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003452
VALIDATED
ZNF189 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 189
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003452.2-2176s1c1
Sequence:CCGGGCTCAATTTGATTTGAGACTACTCGAGTAGTCTCAAATCAAATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003452.2-1759s1c1
Sequence:CCGGCGGAGCTCATTTCTTATTGAACTCGAGTTCAATAAGAAATGAGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_003452.2-1339s1c1
Sequence:CCGGCGGAGCTCATTCCTTATTGAACTCGAGTTCAATAAGGAATGAGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003452.2-835s1c1
Sequence:CCGGCGCAGTTCATTTGTTATTGAACTCGAGTTCAATAACAAATGAACTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003452.2-757s1c1
Sequence:CCGGGCCCATTTCATTCAACATCAACTCGAGTTGATGTTGAATGAAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003452.2-1923s21c1
Sequence:CCGGTAGCCGGAACTCGGGTCTTATCTCGAGATAAGACCCGAGTTCCGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003452.2-583s21c1
Sequence:GTACCGGCTTGTTGGTAGGTTAGATAAACTCGAGTTTATCTAACCTACCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003452.2-1252s21c1
Sequence:CCGGCGATTAAGCACATACCTTATACTCGAGTATAAGGTATGTGCTTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003452.2-2094s21c1
Sequence:CCGGAGCCTTTAATTGCCGTATTTCCTCGAGGAAATACGGCAATTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003452.2-2575s21c1
Sequence:CCGGGTCCAGTGATTAAGCATATATCTCGAGATATATGCTTAATCACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003452
VALIDATED
ZNF189 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 189
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003452.2-2176s1c1
Sequence:CCGGGCTCAATTTGATTTGAGACTACTCGAGTAGTCTCAAATCAAATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003452.2-1759s1c1
Sequence:CCGGCGGAGCTCATTTCTTATTGAACTCGAGTTCAATAAGAAATGAGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_003452.2-1339s1c1
Sequence:CCGGCGGAGCTCATTCCTTATTGAACTCGAGTTCAATAAGGAATGAGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003452.2-835s1c1
Sequence:CCGGCGCAGTTCATTTGTTATTGAACTCGAGTTCAATAACAAATGAACTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003452.2-757s1c1
Sequence:CCGGGCCCATTTCATTCAACATCAACTCGAGTTGATGTTGAATGAAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003452.2-1923s21c1
Sequence:CCGGTAGCCGGAACTCGGGTCTTATCTCGAGATAAGACCCGAGTTCCGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003452.2-583s21c1
Sequence:GTACCGGCTTGTTGGTAGGTTAGATAAACTCGAGTTTATCTAACCTACCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003452.2-1252s21c1
Sequence:CCGGCGATTAAGCACATACCTTATACTCGAGTATAAGGTATGTGCTTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003452.2-2094s21c1
Sequence:CCGGAGCCTTTAATTGCCGTATTTCCTCGAGGAAATACGGCAATTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003452.2-2575s21c1
Sequence:CCGGGTCCAGTGATTAAGCATATATCTCGAGATATATGCTTAATCACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003452
VALIDATED
ZNF189 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 189
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003452.2-2176s1c1
Sequence:CCGGGCTCAATTTGATTTGAGACTACTCGAGTAGTCTCAAATCAAATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003452.2-1759s1c1
Sequence:CCGGCGGAGCTCATTTCTTATTGAACTCGAGTTCAATAAGAAATGAGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_003452.2-1339s1c1
Sequence:CCGGCGGAGCTCATTCCTTATTGAACTCGAGTTCAATAAGGAATGAGCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003452.2-835s1c1
Sequence:CCGGCGCAGTTCATTTGTTATTGAACTCGAGTTCAATAACAAATGAACTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003452.2-757s1c1
Sequence:CCGGGCCCATTTCATTCAACATCAACTCGAGTTGATGTTGAATGAAATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003452.2-1923s21c1
Sequence:CCGGTAGCCGGAACTCGGGTCTTATCTCGAGATAAGACCCGAGTTCCGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003452.2-583s21c1
Sequence:GTACCGGCTTGTTGGTAGGTTAGATAAACTCGAGTTTATCTAACCTACCAACAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003452.2-1252s21c1
Sequence:CCGGCGATTAAGCACATACCTTATACTCGAGTATAAGGTATGTGCTTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003452.2-2094s21c1
Sequence:CCGGAGCCTTTAATTGCCGTATTTCCTCGAGGAAATACGGCAATTAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229692    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003452.2-2575s21c1
Sequence:CCGGGTCCAGTGATTAAGCATATATCTCGAGATATATGCTTAATCACTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks