EMAIL THIS PAGE TO A FRIEND

ZNF18

zinc finger protein 18

Synonyms: HDSG1 KOX11 ZKSCAN6 ZNF535 ZSCAN38 Zfp535
UniProtKB ID: P17022, Q5QHQ3, Q8IYC4, Q8NAH6
Gene ID:
dog(479505) zinc finger protein 18
domestic cat(101085583) zinc finger protein 18
Horse(100073093) zinc finger protein 18
naked mole-rat(101704140) zinc finger protein 18
Domestic Rabbit(100358639) zinc finger protein 18
domestic guinea pig(100733952) zinc finger protein 18
cow(506638) zinc finger protein 18
sheep(101114536) zinc finger protein 18
25 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144680 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_085596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_085596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_085596 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144680 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206902 predicted 2154
2 SASI_Hs01_00206903 predicted 1725
3 SASI_Hs01_00206905 predicted 1278
4 SASI_Hs01_00206906 predicted 2073
5 SASI_Hs01_00206907 predicted 1701
6 SASI_Hs02_00364579 predicted 1948
7 SASI_Hs01_00206908 predicted 1942
8 SASI_Hs01_00206909 predicted 765
9 SASI_Hs01_00206910 predicted 1368
10 SASI_Hs02_00364580 predicted 1484
11 SASI_Hs01_00206904 predicted 2314
12 SASI_Hs01_00206911 predicted 1419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144680
ZNF18 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 18
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144680.2-981s21c1
Sequence:CCGGCTGTGGCAATGGATCAGTATCCTCGAGGATACTGATCCATTGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144680.2-1373s21c1
Sequence:CCGGCAAATCTGACCTGACTAATTCCTCGAGGAATTAGTCAGGTCAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144680.2-1894s21c1
Sequence:CCGGACACCGGAGAGACATACTTTCCTCGAGGAAAGTATGTCTCTCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144680.2-2578s21c1
Sequence:GTACCGGTTAGCTGTAGTCACTGCTTATCTCGAGATAAGCAGTGACTACAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144680.2-1483s21c1
Sequence:CCGGATGACAAGGAGAACCTAAATTCTCGAGAATTTAGGTTCTCCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144680
ZNF18 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 18
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144680.2-981s21c1
Sequence:CCGGCTGTGGCAATGGATCAGTATCCTCGAGGATACTGATCCATTGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144680.2-1373s21c1
Sequence:CCGGCAAATCTGACCTGACTAATTCCTCGAGGAATTAGTCAGGTCAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144680.2-1894s21c1
Sequence:CCGGACACCGGAGAGACATACTTTCCTCGAGGAAAGTATGTCTCTCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144680.2-2578s21c1
Sequence:GTACCGGTTAGCTGTAGTCACTGCTTATCTCGAGATAAGCAGTGACTACAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144680.2-1483s21c1
Sequence:CCGGATGACAAGGAGAACCTAAATTCTCGAGAATTTAGGTTCTCCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144680
ZNF18 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 18
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144680.2-981s21c1
Sequence:CCGGCTGTGGCAATGGATCAGTATCCTCGAGGATACTGATCCATTGCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144680.2-1373s21c1
Sequence:CCGGCAAATCTGACCTGACTAATTCCTCGAGGAATTAGTCAGGTCAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144680.2-1894s21c1
Sequence:CCGGACACCGGAGAGACATACTTTCCTCGAGGAAAGTATGTCTCTCCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144680.2-2578s21c1
Sequence:GTACCGGTTAGCTGTAGTCACTGCTTATCTCGAGATAAGCAGTGACTACAGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144680.2-1483s21c1
Sequence:CCGGATGACAAGGAGAACCTAAATTCTCGAGAATTTAGGTTCTCCTTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_085596
VALIDATED
ZNF18 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 18
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085596.4-2206s1c1
Sequence:CCGGGCCTTGACAAACATCAAAGATCTCGAGATCTTTGATGTTTGTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085596.4-2229s1c1
Sequence:CCGGCACTTAGGAAAGAAGCCCTTTCTCGAGAAAGGGCTTCTTTCCTAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:XM_085596.4-1463s1c1
Sequence:CCGGCATAGGAGATAGACAAGAGAACTCGAGTTCTCTTGTCTATCTCCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:XM_085596.4-1371s1c1
Sequence:CCGGCCCAAATCTGACCTGACTAATCTCGAGATTAGTCAGGTCAGATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085596.4-839s1c1
Sequence:CCGGGCAGATCCTAGAGATCCTCATCTCGAGATGAGGATCTCTAGGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_085596
VALIDATED
ZNF18 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 18
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085596.4-2206s1c1
Sequence:CCGGGCCTTGACAAACATCAAAGATCTCGAGATCTTTGATGTTTGTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085596.4-2229s1c1
Sequence:CCGGCACTTAGGAAAGAAGCCCTTTCTCGAGAAAGGGCTTCTTTCCTAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:XM_085596.4-1463s1c1
Sequence:CCGGCATAGGAGATAGACAAGAGAACTCGAGTTCTCTTGTCTATCTCCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:XM_085596.4-1371s1c1
Sequence:CCGGCCCAAATCTGACCTGACTAATCTCGAGATTAGTCAGGTCAGATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085596.4-839s1c1
Sequence:CCGGGCAGATCCTAGAGATCCTCATCTCGAGATGAGGATCTCTAGGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_085596
VALIDATED
ZNF18 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 18
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085596.4-2206s1c1
Sequence:CCGGGCCTTGACAAACATCAAAGATCTCGAGATCTTTGATGTTTGTCAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085596.4-2229s1c1
Sequence:CCGGCACTTAGGAAAGAAGCCCTTTCTCGAGAAAGGGCTTCTTTCCTAAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:XM_085596.4-1463s1c1
Sequence:CCGGCATAGGAGATAGACAAGAGAACTCGAGTTCTCTTGTCTATCTCCTATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:XM_085596.4-1371s1c1
Sequence:CCGGCCCAAATCTGACCTGACTAATCTCGAGATTAGTCAGGTCAGATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_085596.4-839s1c1
Sequence:CCGGGCAGATCCTAGAGATCCTCATCTCGAGATGAGGATCTCTAGGATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks