EMAIL THIS PAGE TO A FRIEND

ZNF192P1

zinc finger protein 192 pseudogene 1

Synonyms: ZNF389 ZNF389P dJ265C24.4
Species: Human ZNF192P1(651302)
Gene ID:
3 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV51115 Anti-ZNF389 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001145129 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001145129 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001145129 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145129
ZNF192P1 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 192 pseudogene 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145129.1-1111s21c1
Sequence:CCGGAGCCAGATCTCAACGCTTATTCTCGAGAATAAGCGTTGAGATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145129.1-1310s21c1
Sequence:CCGGTGAAAGAAGAGTATGGTTAAACTCGAGTTTAACCATACTCTTCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145129.1-778s21c1
Sequence:CCGGGTAAGGGCACACCTGATTATACTCGAGTATAATCAGGTGTGCCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145129.1-562s21c1
Sequence:CCGGATGGAAGAAAGACGGTATAAACTCGAGTTTATACCGTCTTTCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145129.1-1198s21c1
Sequence:CCGGGGGAGTTCTAACCTTACTAAACTCGAGTTTAGTAAGGTTAGAACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145129
ZNF192P1 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 192 pseudogene 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145129.1-1111s21c1
Sequence:CCGGAGCCAGATCTCAACGCTTATTCTCGAGAATAAGCGTTGAGATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145129.1-1310s21c1
Sequence:CCGGTGAAAGAAGAGTATGGTTAAACTCGAGTTTAACCATACTCTTCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145129.1-778s21c1
Sequence:CCGGGTAAGGGCACACCTGATTATACTCGAGTATAATCAGGTGTGCCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145129.1-562s21c1
Sequence:CCGGATGGAAGAAAGACGGTATAAACTCGAGTTTATACCGTCTTTCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145129.1-1198s21c1
Sequence:CCGGGGGAGTTCTAACCTTACTAAACTCGAGTTTAGTAAGGTTAGAACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145129
ZNF192P1 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 192 pseudogene 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145129.1-1111s21c1
Sequence:CCGGAGCCAGATCTCAACGCTTATTCTCGAGAATAAGCGTTGAGATCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001145129.1-1310s21c1
Sequence:CCGGTGAAAGAAGAGTATGGTTAAACTCGAGTTTAACCATACTCTTCTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145129.1-778s21c1
Sequence:CCGGGTAAGGGCACACCTGATTATACTCGAGTATAATCAGGTGTGCCCTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145129.1-562s21c1
Sequence:CCGGATGGAAGAAAGACGGTATAAACTCGAGTTTATACCGTCTTTCTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145129.1-1198s21c1
Sequence:CCGGGGGAGTTCTAACCTTACTAAACTCGAGTTTAGTAAGGTTAGAACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks