EMAIL THIS PAGE TO A FRIEND

ZNF195

zinc finger protein 195

Synonyms: HRF1 ZNFP104
Species: Human ZNF195(7748)
Gene ID:
Human(7748) Summary: This gene encodes a protein belonging to the Krueppel C2H2-type zinc-finger protein family. These family members are transcription factors that are implicated in a variety of cellular processes. This gene is located near the centromeric border of chromosome 11p15.5, next to an imprinted domain that is associated with maternal-specific loss of heterozygosity in Wilms' tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007152 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122501 MISSION® esiRNA esiRNA human ZNF195 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007152 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343060 predicted 407
2 SASI_Hs01_00012201 predicted 778
3 SASI_Hs02_00343061 predicted 446
4 SASI_Hs01_00012203 predicted 1165
5 SASI_Hs02_00343062 predicted 274
6 SASI_Hs01_00012205 predicted 1129
7 SASI_Hs01_00012206 predicted 615
8 SASI_Hs01_00012207 predicted 608
9 SASI_Hs01_00012208 predicted 908
10 SASI_Hs01_00012202 predicted 784
11 SASI_Hs01_00012204 predicted 1253
12 SASI_Hs01_00012209 predicted 1241
13 SASI_Hs01_00012210 predicted 823
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007152
VALIDATED
ZNF195 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 195
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007152.2-1428s21c1
Sequence:CCGGGCAACATCTTTAAGCAGTTATCTCGAGATAACTGCTTAAAGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007152.2-456s21c1
Sequence:CCGGGAAATTGTGGCCTTGATAATTCTCGAGAATTATCAAGGCCACAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007152.2-1843s21c1
Sequence:CCGGATAGGCAAAGCCGTTAGTATCCTCGAGGATACTAACGGCTTTGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007152.2-789s21c1
Sequence:CCGGTTACTGAACCTGAGAACATTGCTCGAGCAATGTTCTCAGGTTCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007152.2-839s21c1
Sequence:CCGGGAATGTAACAACGTCATTAAACTCGAGTTTAATGACGTTGTTACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007152.1-1149s1c1
Sequence:CCGGCCTTTCTAATCAACAGATGATCTCGAGATCATCTGTTGATTAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007152.1-1557s1c1
Sequence:CCGGGCAGTTATCAGACCTCACTAACTCGAGTTAGTGAGGTCTGATAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007152.1-952s1c1
Sequence:CCGGCAAGAATGTAACAACGTCATTCTCGAGAATGACGTTGTTACATTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007152.1-390s1c1
Sequence:CCGGCCTCAATGTTTCTGTGGACAACTCGAGTTGTCCACAGAAACATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_007152.1-2072s1c1
Sequence:CCGGCCAGAGCACACAAGAGTATTTCTCGAGAAATACTCTTGTGTGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007152
VALIDATED
ZNF195 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 195
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007152.2-1428s21c1
Sequence:CCGGGCAACATCTTTAAGCAGTTATCTCGAGATAACTGCTTAAAGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007152.2-456s21c1
Sequence:CCGGGAAATTGTGGCCTTGATAATTCTCGAGAATTATCAAGGCCACAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007152.2-1843s21c1
Sequence:CCGGATAGGCAAAGCCGTTAGTATCCTCGAGGATACTAACGGCTTTGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007152.2-789s21c1
Sequence:CCGGTTACTGAACCTGAGAACATTGCTCGAGCAATGTTCTCAGGTTCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007152.2-839s21c1
Sequence:CCGGGAATGTAACAACGTCATTAAACTCGAGTTTAATGACGTTGTTACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007152.1-1149s1c1
Sequence:CCGGCCTTTCTAATCAACAGATGATCTCGAGATCATCTGTTGATTAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007152.1-1557s1c1
Sequence:CCGGGCAGTTATCAGACCTCACTAACTCGAGTTAGTGAGGTCTGATAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007152.1-952s1c1
Sequence:CCGGCAAGAATGTAACAACGTCATTCTCGAGAATGACGTTGTTACATTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007152.1-390s1c1
Sequence:CCGGCCTCAATGTTTCTGTGGACAACTCGAGTTGTCCACAGAAACATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_007152.1-2072s1c1
Sequence:CCGGCCAGAGCACACAAGAGTATTTCTCGAGAAATACTCTTGTGTGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007152
VALIDATED
ZNF195 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 195
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007152.2-1428s21c1
Sequence:CCGGGCAACATCTTTAAGCAGTTATCTCGAGATAACTGCTTAAAGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007152.2-456s21c1
Sequence:CCGGGAAATTGTGGCCTTGATAATTCTCGAGAATTATCAAGGCCACAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007152.2-1843s21c1
Sequence:CCGGATAGGCAAAGCCGTTAGTATCCTCGAGGATACTAACGGCTTTGCCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007152.2-789s21c1
Sequence:CCGGTTACTGAACCTGAGAACATTGCTCGAGCAATGTTCTCAGGTTCAGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007152.2-839s21c1
Sequence:CCGGGAATGTAACAACGTCATTAAACTCGAGTTTAATGACGTTGTTACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007152.1-1149s1c1
Sequence:CCGGCCTTTCTAATCAACAGATGATCTCGAGATCATCTGTTGATTAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007152.1-1557s1c1
Sequence:CCGGGCAGTTATCAGACCTCACTAACTCGAGTTAGTGAGGTCTGATAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007152.1-952s1c1
Sequence:CCGGCAAGAATGTAACAACGTCATTCTCGAGAATGACGTTGTTACATTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007152.1-390s1c1
Sequence:CCGGCCTCAATGTTTCTGTGGACAACTCGAGTTGTCCACAGAAACATTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013023    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A3
TRC Version: 1 Clone ID:NM_007152.1-2072s1c1
Sequence:CCGGCCAGAGCACACAAGAGTATTTCTCGAGAAATACTCTTGTGTGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks