EMAIL THIS PAGE TO A FRIEND

ZNF197

zinc finger protein 197

Synonyms: D3S1363E P18 VHLaK ZKSCAN9 ZNF166 ZNF20 ZSCAN41
UniProtKB ID: O14709, B2RAH8, Q86VG0
Gene ID:
Human(10168) Summary: This gene product belongs to the zinc finger protein superfamily, members of which are regulatory proteins characterized by nucleic acid-binding zinc finger domains. The encoded protein contains 20 tandemly arrayed C2H2-type zinc fingers, a Kruppel-associated box (KRAB) domain, and a SCAN box. This transcript turns over rapidly and contains 3' UTR AUUUA motifs, which are often a hallmark of rapid turnover. It is overexpressed in some thyroid papillary carcinomas. This gene is located in a cluster of zinc finger genes at 3p21. Two alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
dog(491421) zinc finger protein 197
domestic cat(101099396) zinc finger protein 197
cow(515564) zinc finger protein 197
sheep(101120022) zinc finger protein 197
Domestic Rabbit(100341429) zinc finger protein 197
domestic guinea pig(100712589) zinc finger protein 197
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006991 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006991 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006991 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU094681 MISSION® esiRNA esiRNA human ZNF197 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024855 Rosetta Predictions human pricing
NM_006991 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307255 predicted 600
2 SASI_Hs01_00111099 predicted 337
3 SASI_Hs01_00111100 predicted 352
4 SASI_Hs01_00111101 predicted 690
5 SASI_Hs01_00111102 predicted 330
6 SASI_Hs01_00111103 predicted 339
7 SASI_Hs01_00111104 predicted 717
8 SASI_Hs01_00111105 predicted 584
9 SASI_Hs01_00111106 predicted 582
10 SASI_Hs01_00111107 predicted 330
11 SASI_Hs01_00111098 predicted 585
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342743 predicted 599
2 SASI_Hs01_00123390 predicted 328
3 SASI_Hs01_00123391 predicted 340
4 SASI_Hs01_00123392 predicted 674
5 SASI_Hs01_00123393 predicted 328
6 SASI_Hs01_00123394 predicted 331
7 SASI_Hs01_00123395 predicted 713
8 SASI_Hs01_00123396 predicted 567
9 SASI_Hs01_00123397 predicted 571
10 SASI_Hs01_00123398 predicted 325
11 SASI_Hs01_00123389 predicted 576
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006991
ZNF197 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 197
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006991.2-3531s1c1
Sequence:CCGGCCCAACTTTCAAGTCTACAAACTCGAGTTTGTAGACTTGAAAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006991.2-127s1c1
Sequence:CCGGCCACCTACACTTTAGACAATTCTCGAGAATTGTCTAAAGTGTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006991.2-2492s1c1
Sequence:CCGGCGCTCAAACCTTATAGCCCATCTCGAGATGGGCTATAAGGTTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006991.2-2065s1c1
Sequence:CCGGCGGTTCAAACAGAAACCTCATCTCGAGATGAGGTTTCTGTTTGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006991.3-322s21c1
Sequence:CCGGAGACCTCCCACCTACACTTTACTCGAGTAAAGTGTAGGTGGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006991.3-1437s21c1
Sequence:CCGGTCGAGCCTTCTAATGCATTTACTCGAGTAAATGCATTAGAAGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006991.3-2688s21c1
Sequence:GTACCGGAGTTACCGCTCAAACCTTATACTCGAGTATAAGGTTTGAGCGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006991.3-3315s21c1
Sequence:CCGGATAGAATCCCTGCCTACTTAACTCGAGTTAAGTAGGCAGGGATTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006991.3-1259s21c1
Sequence:CCGGGACTTTCGGTTCAGCTATTTCCTCGAGGAAATAGCTGAACCGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006991
ZNF197 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 197
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006991.2-3531s1c1
Sequence:CCGGCCCAACTTTCAAGTCTACAAACTCGAGTTTGTAGACTTGAAAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006991.2-127s1c1
Sequence:CCGGCCACCTACACTTTAGACAATTCTCGAGAATTGTCTAAAGTGTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006991.2-2492s1c1
Sequence:CCGGCGCTCAAACCTTATAGCCCATCTCGAGATGGGCTATAAGGTTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006991.2-2065s1c1
Sequence:CCGGCGGTTCAAACAGAAACCTCATCTCGAGATGAGGTTTCTGTTTGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006991.3-322s21c1
Sequence:CCGGAGACCTCCCACCTACACTTTACTCGAGTAAAGTGTAGGTGGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006991.3-1437s21c1
Sequence:CCGGTCGAGCCTTCTAATGCATTTACTCGAGTAAATGCATTAGAAGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006991.3-2688s21c1
Sequence:GTACCGGAGTTACCGCTCAAACCTTATACTCGAGTATAAGGTTTGAGCGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006991.3-3315s21c1
Sequence:CCGGATAGAATCCCTGCCTACTTAACTCGAGTTAAGTAGGCAGGGATTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006991.3-1259s21c1
Sequence:CCGGGACTTTCGGTTCAGCTATTTCCTCGAGGAAATAGCTGAACCGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006991
ZNF197 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 197
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006991.2-3531s1c1
Sequence:CCGGCCCAACTTTCAAGTCTACAAACTCGAGTTTGTAGACTTGAAAGTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006991.2-127s1c1
Sequence:CCGGCCACCTACACTTTAGACAATTCTCGAGAATTGTCTAAAGTGTAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006991.2-2492s1c1
Sequence:CCGGCGCTCAAACCTTATAGCCCATCTCGAGATGGGCTATAAGGTTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006991.2-2065s1c1
Sequence:CCGGCGGTTCAAACAGAAACCTCATCTCGAGATGAGGTTTCTGTTTGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006991.3-322s21c1
Sequence:CCGGAGACCTCCCACCTACACTTTACTCGAGTAAAGTGTAGGTGGGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006991.3-1437s21c1
Sequence:CCGGTCGAGCCTTCTAATGCATTTACTCGAGTAAATGCATTAGAAGGCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006991.3-2688s21c1
Sequence:GTACCGGAGTTACCGCTCAAACCTTATACTCGAGTATAAGGTTTGAGCGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234353    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006991.3-3315s21c1
Sequence:CCGGATAGAATCCCTGCCTACTTAACTCGAGTTAAGTAGGCAGGGATTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006991.3-1259s21c1
Sequence:CCGGGACTTTCGGTTCAGCTATTTCCTCGAGGAAATAGCTGAACCGAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks