EMAIL THIS PAGE TO A FRIEND

ZNF19

zinc finger protein 19

Synonyms: KOX12
UniProtKB ID: P17023, A8K895, Q86Y66, Q8NDE2, Q96M79, Q96NE5
Gene ID:
Human(7567) Summary: The protein encoded by this gene contains a zinc finger, a nucleic acid-binding domain present in many transcription factors. This gene is located in a region next to ZNF23, a gene also encoding a zinc finger protein, on chromosome 16. [provided by RefSeq, Jul 2008]
Horse(100054614) zinc finger protein 19
dog(489721) zinc finger protein 19
cow(532079) zinc finger protein 19
sheep(101105593) zinc finger protein 19
Domestic Rabbit(100357572) zinc finger protein 19
22 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006961 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006961 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006961 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050151 MISSION® esiRNA esiRNA human ZNF19 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006961 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044854 predicted 1332
2 SASI_Hs01_00044856 predicted 992
3 SASI_Hs01_00044857 predicted 943
4 SASI_Hs01_00044858 predicted 277
5 SASI_Hs01_00044859 predicted 649
6 SASI_Hs01_00044860 predicted 579
7 SASI_Hs01_00044861 predicted 342
8 SASI_Hs01_00044862 predicted 567
9 SASI_Hs01_00044863 predicted 703
10 SASI_Hs02_00342701 predicted 993
11 SASI_Hs01_00044855 predicted 860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006961
ZNF19 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 19
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1465s21c1
Sequence:CCGGATCTTCATCAGCATCAAAGAACTCGAGTTCTTTGATGCTGATGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-651s21c1
Sequence:CCGGGACTTCCCAGAAACACGTAATCTCGAGATTACGTGTTTCTGGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1250s21c1
Sequence:CCGGGCCTTATTCTTGTAAAGTATGCTCGAGCATACTTTACAAGAATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1646s21c1
Sequence:CCGGATAGTACACTCCAGTGAAATGCTCGAGCATTTCACTGGAGTGTACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1334s21c1
Sequence:CCGGACCCTTTGACTGTGTAGATTGCTCGAGCAATCTACACAGTCAAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1010s21c1
Sequence:CCGGTACAGAGTGTGGGAATAGTTTCTCGAGAAACTATTCCCACACTCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006961.3-1882s21c1
Sequence:CCGGACTCTTACAGAGGTGAGAATGCTCGAGCATTCTCACCTCTGTAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-707s21c1
Sequence:CCGGTATCCAAGGAAAGGTTCCAAGCTCGAGCTTGGAACCTTTCCTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1555s21c1
Sequence:CCGGGTCACCTTGAGCATGTCTACTCTCGAGAGTAGACATGCTCAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006961.2-1732s1c1
Sequence:CCGGGCCACAGTTAATGATTCAGATCTCGAGATCTGAATCATTAACTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006961.2-558s1c1
Sequence:CCGGCCACATTAATCCAGGGAATTTCTCGAGAAATTCCCTGGATTAATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006961.2-1395s1c1
Sequence:CCGGCTCAGGAGTCTTCCTATGTATCTCGAGATACATAGGAAGACTCCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006961.2-1202s1c1
Sequence:CCGGCTAAGCCAACATCAGCGTATTCTCGAGAATACGCTGATGTTGGCTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006961.2-1020s1c1
Sequence:CCGGCGAGTAGTTCCGAGTTTGTTACTCGAGTAACAAACTCGGAACTACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006961
ZNF19 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 19
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1465s21c1
Sequence:CCGGATCTTCATCAGCATCAAAGAACTCGAGTTCTTTGATGCTGATGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-651s21c1
Sequence:CCGGGACTTCCCAGAAACACGTAATCTCGAGATTACGTGTTTCTGGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1250s21c1
Sequence:CCGGGCCTTATTCTTGTAAAGTATGCTCGAGCATACTTTACAAGAATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1646s21c1
Sequence:CCGGATAGTACACTCCAGTGAAATGCTCGAGCATTTCACTGGAGTGTACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1334s21c1
Sequence:CCGGACCCTTTGACTGTGTAGATTGCTCGAGCAATCTACACAGTCAAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1010s21c1
Sequence:CCGGTACAGAGTGTGGGAATAGTTTCTCGAGAAACTATTCCCACACTCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006961.3-1882s21c1
Sequence:CCGGACTCTTACAGAGGTGAGAATGCTCGAGCATTCTCACCTCTGTAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-707s21c1
Sequence:CCGGTATCCAAGGAAAGGTTCCAAGCTCGAGCTTGGAACCTTTCCTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1555s21c1
Sequence:CCGGGTCACCTTGAGCATGTCTACTCTCGAGAGTAGACATGCTCAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006961.2-1732s1c1
Sequence:CCGGGCCACAGTTAATGATTCAGATCTCGAGATCTGAATCATTAACTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006961.2-558s1c1
Sequence:CCGGCCACATTAATCCAGGGAATTTCTCGAGAAATTCCCTGGATTAATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006961.2-1395s1c1
Sequence:CCGGCTCAGGAGTCTTCCTATGTATCTCGAGATACATAGGAAGACTCCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006961.2-1202s1c1
Sequence:CCGGCTAAGCCAACATCAGCGTATTCTCGAGAATACGCTGATGTTGGCTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006961.2-1020s1c1
Sequence:CCGGCGAGTAGTTCCGAGTTTGTTACTCGAGTAACAAACTCGGAACTACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006961
ZNF19 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 19
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1465s21c1
Sequence:CCGGATCTTCATCAGCATCAAAGAACTCGAGTTCTTTGATGCTGATGAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-651s21c1
Sequence:CCGGGACTTCCCAGAAACACGTAATCTCGAGATTACGTGTTTCTGGGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1250s21c1
Sequence:CCGGGCCTTATTCTTGTAAAGTATGCTCGAGCATACTTTACAAGAATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1646s21c1
Sequence:CCGGATAGTACACTCCAGTGAAATGCTCGAGCATTTCACTGGAGTGTACTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1334s21c1
Sequence:CCGGACCCTTTGACTGTGTAGATTGCTCGAGCAATCTACACAGTCAAAGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1010s21c1
Sequence:CCGGTACAGAGTGTGGGAATAGTTTCTCGAGAAACTATTCCCACACTCTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006961.3-1882s21c1
Sequence:CCGGACTCTTACAGAGGTGAGAATGCTCGAGCATTCTCACCTCTGTAAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-707s21c1
Sequence:CCGGTATCCAAGGAAAGGTTCCAAGCTCGAGCTTGGAACCTTTCCTTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006961.3-1555s21c1
Sequence:CCGGGTCACCTTGAGCATGTCTACTCTCGAGAGTAGACATGCTCAAGGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006961.2-1732s1c1
Sequence:CCGGGCCACAGTTAATGATTCAGATCTCGAGATCTGAATCATTAACTGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006961.2-558s1c1
Sequence:CCGGCCACATTAATCCAGGGAATTTCTCGAGAAATTCCCTGGATTAATGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006961.2-1395s1c1
Sequence:CCGGCTCAGGAGTCTTCCTATGTATCTCGAGATACATAGGAAGACTCCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006961.2-1202s1c1
Sequence:CCGGCTAAGCCAACATCAGCGTATTCTCGAGAATACGCTGATGTTGGCTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006961.2-1020s1c1
Sequence:CCGGCGAGTAGTTCCGAGTTTGTTACTCGAGTAACAAACTCGGAACTACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks