EMAIL THIS PAGE TO A FRIEND

ZNF200

zinc finger protein 200

UniProtKB ID: P98182, D3DUB7, D3DUB8, O15361, Q5XKM5, Q7Z5V1
Gene ID:
Horse(100069266) zinc finger protein 200
dog(490042) zinc finger protein 200
domestic cat(101096942) zinc finger protein 200
cow(521662) zinc finger protein 200
sheep(101120038) zinc finger protein 200
naked mole-rat(101701235) zinc finger protein 200
domestic guinea pig(100716215) zinc finger protein 200
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003454 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003454 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003454 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121281 MISSION® esiRNA esiRNA human ZNF200 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003454 Rosetta Predictions human pricing
NM_198087 Rosetta Predictions human pricing
NM_198088 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188521 predicted 1836
2 SASI_Hs01_00188522 predicted 2030
3 SASI_Hs02_00335690 predicted 2057
4 SASI_Hs01_00188523 predicted 1510
5 SASI_Hs01_00188524 predicted 1733
6 SASI_Hs01_00188525 predicted 2016
7 SASI_Hs01_00188526 predicted 1734
8 SASI_Hs01_00188527 predicted 1687
9 SASI_Hs01_00188528 predicted 1505
10 SASI_Hs01_00188530 predicted 1821
11 SASI_Hs01_00188529 predicted 2087
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198087 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119865 predicted 1361
2 SASI_Hs01_00119866 predicted 1554
3 SASI_Hs02_00371647 predicted 1580
4 SASI_Hs01_00119867 predicted 1036
5 SASI_Hs01_00119868 predicted 1250
6 SASI_Hs01_00119869 predicted 1532
7 SASI_Hs01_00119870 predicted 1254
8 SASI_Hs01_00119871 predicted 1208
9 SASI_Hs01_00119872 predicted 1024
10 SASI_Hs01_00119874 predicted 1341
11 SASI_Hs01_00119873 predicted 1610
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107620 predicted 1485
2 SASI_Hs01_00107621 predicted 1686
3 SASI_Hs02_00371648 predicted 1707
4 SASI_Hs01_00107622 predicted 1160
5 SASI_Hs01_00107623 predicted 1380
6 SASI_Hs01_00107624 predicted 1658
7 SASI_Hs01_00107625 predicted 1379
8 SASI_Hs01_00107626 predicted 1334
9 SASI_Hs01_00107627 predicted 1148
10 SASI_Hs01_00107629 predicted 1473
11 SASI_Hs01_00107628 predicted 1744
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003454
VALIDATED
ZNF200 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 200
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003454.2-1310s21c1
Sequence:CCGGTGATGTTACTGGCAGTCAATGCTCGAGCATTGACTGCCAGTAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003454.2-2026s21c1
Sequence:CCGGACCCGAAAGCAGAAGTAATACCTCGAGGTATTACTTCTGCTTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003454.2-3210s21c1
Sequence:CCGGTGATCGTGTGGTGCGATTTAGCTCGAGCTAAATCGCACCACACGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003454.2-1829s21c1
Sequence:CCGGGTCATGAAGGAATCCATATAACTCGAGTTATATGGATTCCTTCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003454.2-1621s21c1
Sequence:GTACCGGCTGTGTGGGAAACAGTTTAATCTCGAGATTAAACTGTTTCCCACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003454.2-886s1c1
Sequence:CCGGCCAAAGCCAAAGCAGTCCTTTCTCGAGAAAGGACTGCTTTGGCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_003454.2-1967s1c1
Sequence:CCGGGAAGATTTGGTCGGCTGTCAACTCGAGTTGACAGCCGACCAAATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003454.2-898s1c1
Sequence:CCGGCAGTCCTTTATACTGAGAGTTCTCGAGAACTCTCAGTATAAAGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003454.2-1462s1c1
Sequence:CCGGGAACGACTAAATACATCCATTCTCGAGAATGGATGTATTTAGTCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003454.2-1197s1c1
Sequence:CCGGGCTGGTGGTCTTTGAGGATTTCTCGAGAAATCCTCAAAGACCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003454
VALIDATED
ZNF200 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 200
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003454.2-1310s21c1
Sequence:CCGGTGATGTTACTGGCAGTCAATGCTCGAGCATTGACTGCCAGTAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003454.2-2026s21c1
Sequence:CCGGACCCGAAAGCAGAAGTAATACCTCGAGGTATTACTTCTGCTTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003454.2-3210s21c1
Sequence:CCGGTGATCGTGTGGTGCGATTTAGCTCGAGCTAAATCGCACCACACGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003454.2-1829s21c1
Sequence:CCGGGTCATGAAGGAATCCATATAACTCGAGTTATATGGATTCCTTCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003454.2-1621s21c1
Sequence:GTACCGGCTGTGTGGGAAACAGTTTAATCTCGAGATTAAACTGTTTCCCACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003454.2-886s1c1
Sequence:CCGGCCAAAGCCAAAGCAGTCCTTTCTCGAGAAAGGACTGCTTTGGCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_003454.2-1967s1c1
Sequence:CCGGGAAGATTTGGTCGGCTGTCAACTCGAGTTGACAGCCGACCAAATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003454.2-898s1c1
Sequence:CCGGCAGTCCTTTATACTGAGAGTTCTCGAGAACTCTCAGTATAAAGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003454.2-1462s1c1
Sequence:CCGGGAACGACTAAATACATCCATTCTCGAGAATGGATGTATTTAGTCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003454.2-1197s1c1
Sequence:CCGGGCTGGTGGTCTTTGAGGATTTCTCGAGAAATCCTCAAAGACCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003454
VALIDATED
ZNF200 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 200
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003454.2-1310s21c1
Sequence:CCGGTGATGTTACTGGCAGTCAATGCTCGAGCATTGACTGCCAGTAACATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003454.2-2026s21c1
Sequence:CCGGACCCGAAAGCAGAAGTAATACCTCGAGGTATTACTTCTGCTTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229345    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003454.2-3210s21c1
Sequence:CCGGTGATCGTGTGGTGCGATTTAGCTCGAGCTAAATCGCACCACACGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003454.2-1829s21c1
Sequence:CCGGGTCATGAAGGAATCCATATAACTCGAGTTATATGGATTCCTTCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003454.2-1621s21c1
Sequence:GTACCGGCTGTGTGGGAAACAGTTTAATCTCGAGATTAAACTGTTTCCCACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003454.2-886s1c1
Sequence:CCGGCCAAAGCCAAAGCAGTCCTTTCTCGAGAAAGGACTGCTTTGGCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_003454.2-1967s1c1
Sequence:CCGGGAAGATTTGGTCGGCTGTCAACTCGAGTTGACAGCCGACCAAATCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003454.2-898s1c1
Sequence:CCGGCAGTCCTTTATACTGAGAGTTCTCGAGAACTCTCAGTATAAAGGACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003454.2-1462s1c1
Sequence:CCGGGAACGACTAAATACATCCATTCTCGAGAATGGATGTATTTAGTCGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003454.2-1197s1c1
Sequence:CCGGGCTGGTGGTCTTTGAGGATTTCTCGAGAAATCCTCAAAGACCACCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks