EMAIL THIS PAGE TO A FRIEND

ZNF202

zinc finger protein 202

Synonyms: ZKSCAN10 ZSCAN42
UniProtKB ID: O95125, B0LPH9, Q4JG21, Q9H1B9, Q9NSM4
Gene ID:
domestic guinea pig(100720627) zinc finger protein 202
naked mole-rat(101701635) zinc finger protein 202
cow(541023) zinc finger protein 202
sheep(101113358) zinc finger protein 202
Horse(100063670) zinc finger protein 202
domestic cat(101088516) zinc finger protein 202
dog(489351) zinc finger protein 202
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003455 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123631 MISSION® esiRNA esiRNA human ZNF202 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003455 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233887 predicted 1476
2 SASI_Hs01_00233888 predicted 1337
3 SASI_Hs01_00233889 predicted 1508
4 SASI_Hs01_00233890 predicted 1490
5 SASI_Hs01_00233891 predicted 1999
6 SASI_Hs01_00233892 predicted 1828
7 SASI_Hs02_00335691 predicted 2363
8 SASI_Hs01_00233894 predicted 2295
9 SASI_Hs01_00233895 predicted 1577
10 SASI_Hs02_00335692 predicted 1844
11 SASI_Hs01_00233886 predicted 1218
12 SASI_Hs01_00233893 predicted 1115
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003455
VALIDATED
ZNF202 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 202
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003455.1-3826s1c1
Sequence:CCGGGCCTGGAGTTTGCAGAAGATACTCGAGTATCTTCTGCAAACTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_003455.1-1433s1c1
Sequence:CCGGCCATCAGTGGAGAAACCCTATCTCGAGATAGGGTTTCTCCACTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003455.1-284s1c1
Sequence:CCGGGAACAATTTCTTACCGTCCTACTCGAGTAGGACGGTAAGAAATTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003455.1-44s1c1
Sequence:CCGGCTTTGGGAAGAAGAGGGAATTCTCGAGAATTCCCTCTTCTTCCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003455.1-1902s1c1
Sequence:CCGGGCAGAGGATATCACTTAATTACTCGAGTAATTAAGTGATATCCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003455.2-2475s21c1
Sequence:CCGGTTACCTCTTCCTGCAACTAAACTCGAGTTTAGTTGCAGGAAGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_003455.2-1477s21c1
Sequence:CCGGGGACAATCCAGGTAGACTTAACTCGAGTTAAGTCTACCTGGATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003455.2-1346s21c1
Sequence:CCGGTACACAGGAGATAGGAGTAAACTCGAGTTTACTCCTATCTCCTGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003455.2-2289s21c1
Sequence:GTACCGGTCAGCAGAGGATATCACTTAACTCGAGTTAAGTGATATCCTCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003455.2-1395s21c1
Sequence:CCGGATCTGAGTTTGGAGGATATACCTCGAGGTATATCCTCCAAACTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003455
VALIDATED
ZNF202 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 202
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003455.1-3826s1c1
Sequence:CCGGGCCTGGAGTTTGCAGAAGATACTCGAGTATCTTCTGCAAACTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_003455.1-1433s1c1
Sequence:CCGGCCATCAGTGGAGAAACCCTATCTCGAGATAGGGTTTCTCCACTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003455.1-284s1c1
Sequence:CCGGGAACAATTTCTTACCGTCCTACTCGAGTAGGACGGTAAGAAATTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003455.1-44s1c1
Sequence:CCGGCTTTGGGAAGAAGAGGGAATTCTCGAGAATTCCCTCTTCTTCCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003455.1-1902s1c1
Sequence:CCGGGCAGAGGATATCACTTAATTACTCGAGTAATTAAGTGATATCCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003455.2-2475s21c1
Sequence:CCGGTTACCTCTTCCTGCAACTAAACTCGAGTTTAGTTGCAGGAAGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_003455.2-1477s21c1
Sequence:CCGGGGACAATCCAGGTAGACTTAACTCGAGTTAAGTCTACCTGGATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003455.2-1346s21c1
Sequence:CCGGTACACAGGAGATAGGAGTAAACTCGAGTTTACTCCTATCTCCTGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003455.2-2289s21c1
Sequence:GTACCGGTCAGCAGAGGATATCACTTAACTCGAGTTAAGTGATATCCTCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003455.2-1395s21c1
Sequence:CCGGATCTGAGTTTGGAGGATATACCTCGAGGTATATCCTCCAAACTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003455
VALIDATED
ZNF202 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 202
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003455.1-3826s1c1
Sequence:CCGGGCCTGGAGTTTGCAGAAGATACTCGAGTATCTTCTGCAAACTCCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013030    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_003455.1-1433s1c1
Sequence:CCGGCCATCAGTGGAGAAACCCTATCTCGAGATAGGGTTTCTCCACTGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003455.1-284s1c1
Sequence:CCGGGAACAATTTCTTACCGTCCTACTCGAGTAGGACGGTAAGAAATTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003455.1-44s1c1
Sequence:CCGGCTTTGGGAAGAAGAGGGAATTCTCGAGAATTCCCTCTTCTTCCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003455.1-1902s1c1
Sequence:CCGGGCAGAGGATATCACTTAATTACTCGAGTAATTAAGTGATATCCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230108    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003455.2-2475s21c1
Sequence:CCGGTTACCTCTTCCTGCAACTAAACTCGAGTTTAGTTGCAGGAAGAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_003455.2-1477s21c1
Sequence:CCGGGGACAATCCAGGTAGACTTAACTCGAGTTAAGTCTACCTGGATTGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003455.2-1346s21c1
Sequence:CCGGTACACAGGAGATAGGAGTAAACTCGAGTTTACTCCTATCTCCTGTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003455.2-2289s21c1
Sequence:GTACCGGTCAGCAGAGGATATCACTTAACTCGAGTTAAGTGATATCCTCTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003455.2-1395s21c1
Sequence:CCGGATCTGAGTTTGGAGGATATACCTCGAGGTATATCCTCCAAACTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks