EMAIL THIS PAGE TO A FRIEND

ZNF205

zinc finger protein 205

Synonyms: RhitH ZNF210 Zfp13
UniProtKB ID: O95201, A8MZK0, D3DUB4, Q9BU95
Gene ID:
dog(479870) zinc finger protein 205
domestic cat(101098915) zinc finger protein 205
cow(514765) zinc finger protein 205
sheep(101119270) zinc finger protein 205
naked mole-rat(101726486) zinc finger protein 205
domestic guinea pig(101787828) zinc finger protein 205
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA001791 Anti-ZNF205 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV38353 Anti-ZNF205 antibody produced in rabbit IgG fraction of antiserum canine, human, guinea pig, bovine, mouse
western blot pricing
SAB2102818 Anti-ZNF205 antibody produced in rabbit affinity isolated antibody mouse, guinea pig, rabbit, human, rat, bovine, horse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003456 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136911 MISSION® esiRNA esiRNA human ZNF205 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031686 Rosetta Predictions human pricing
NM_001042428 Rosetta Predictions human pricing
NM_003456 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186977 predicted 894
2 SASI_Hs01_00186978 predicted 732
3 SASI_Hs01_00186979 predicted 508
4 SASI_Hs01_00186980 predicted 1181
5 SASI_Hs01_00186981 predicted 983
6 SASI_Hs01_00186982 predicted 520
7 SASI_Hs01_00186983 predicted 634
8 SASI_Hs01_00186984 predicted 1453
9 SASI_Hs01_00186985 predicted 827
10 SASI_Hs01_00186986 predicted 1058
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042428 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309718 predicted 861
2 SASI_Hs02_00309719 predicted 703
3 SASI_Hs02_00309720 predicted 472
4 SASI_Hs02_00309721 predicted 362
5 SASI_Hs02_00309722 predicted 1145
6 SASI_Hs02_00309723 predicted 1073
7 SASI_Hs02_00309724 predicted 1507
8 SASI_Hs02_00309725 predicted 583
9 SASI_Hs02_00309726 predicted 961
10 SASI_Hs02_00309727 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169023 predicted 925
2 SASI_Hs01_00169024 predicted 774
3 SASI_Hs01_00169025 predicted 540
4 SASI_Hs02_00335693 predicted 434
5 SASI_Hs01_00169026 predicted 1217
6 SASI_Hs02_00335694 predicted 1143
7 SASI_Hs02_00335695 predicted 1577
8 SASI_Hs02_00335696 predicted 651
9 SASI_Hs02_00335697 predicted 1033
10 SASI_Hs02_00335698 predicted 649
11 SASI_Hs01_00169027 predicted 978
12 SASI_Hs01_00169028 predicted 517
13 SASI_Hs01_00169029 predicted 639
14 SASI_Hs01_00169030 predicted 1450
15 SASI_Hs01_00169031 predicted 822
16 SASI_Hs01_00169032 predicted 1052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003456
ZNF205 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 205
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003456.2-258s21c1
Sequence:CCGGGAGGTTCCAGATCGTGGACATCTCGAGATGTCCACGATCTGGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003456.2-673s21c1
Sequence:CCGGATGGGCTGTCACTGGGCTTTCCTCGAGGAAAGCCCAGTGACAGCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003456.2-1326s21c1
Sequence:CCGGCACCACTCCACGCTGATTCAGCTCGAGCTGAATCAGCGTGGAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003456.2-281s21c1
Sequence:CCGGTCATCAGGAAATGCCTTCTAACTCGAGTTAGAAGGCATTTCCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003456.1-580s1c1
Sequence:CCGGGCTGGACCACACGCAGCAGAACTCGAGTTCTGCTGCGTGTGGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003456.1-1369s1c1
Sequence:CCGGCCGCTCGGACTTGGTCACCCACTCGAGTGGGTGACCAAGTCCGAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003456.1-991s1c1
Sequence:CCGGCGTCCCGGAGAAGCCCAACGACTCGAGTCGTTGGGCTTCTCCGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003456.1-1678s1c1
Sequence:CCGGCCCGTTGTGTGGCAAGAGCTTCTCGAGAAGCTCTTGCCACACAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003456.1-505s1c1
Sequence:CCGGCCTCACTGCCTGGTCCCAGATCTCGAGATCTGGGACCAGGCAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003456
ZNF205 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 205
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003456.2-258s21c1
Sequence:CCGGGAGGTTCCAGATCGTGGACATCTCGAGATGTCCACGATCTGGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003456.2-673s21c1
Sequence:CCGGATGGGCTGTCACTGGGCTTTCCTCGAGGAAAGCCCAGTGACAGCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003456.2-1326s21c1
Sequence:CCGGCACCACTCCACGCTGATTCAGCTCGAGCTGAATCAGCGTGGAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003456.2-281s21c1
Sequence:CCGGTCATCAGGAAATGCCTTCTAACTCGAGTTAGAAGGCATTTCCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003456.1-580s1c1
Sequence:CCGGGCTGGACCACACGCAGCAGAACTCGAGTTCTGCTGCGTGTGGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003456.1-1369s1c1
Sequence:CCGGCCGCTCGGACTTGGTCACCCACTCGAGTGGGTGACCAAGTCCGAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003456.1-991s1c1
Sequence:CCGGCGTCCCGGAGAAGCCCAACGACTCGAGTCGTTGGGCTTCTCCGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003456.1-1678s1c1
Sequence:CCGGCCCGTTGTGTGGCAAGAGCTTCTCGAGAAGCTCTTGCCACACAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003456.1-505s1c1
Sequence:CCGGCCTCACTGCCTGGTCCCAGATCTCGAGATCTGGGACCAGGCAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003456
ZNF205 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 205
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003456.2-258s21c1
Sequence:CCGGGAGGTTCCAGATCGTGGACATCTCGAGATGTCCACGATCTGGAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003456.2-673s21c1
Sequence:CCGGATGGGCTGTCACTGGGCTTTCCTCGAGGAAAGCCCAGTGACAGCCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003456.2-1326s21c1
Sequence:CCGGCACCACTCCACGCTGATTCAGCTCGAGCTGAATCAGCGTGGAGTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003456.2-281s21c1
Sequence:CCGGTCATCAGGAAATGCCTTCTAACTCGAGTTAGAAGGCATTTCCTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003456.1-580s1c1
Sequence:CCGGGCTGGACCACACGCAGCAGAACTCGAGTTCTGCTGCGTGTGGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003456.1-1369s1c1
Sequence:CCGGCCGCTCGGACTTGGTCACCCACTCGAGTGGGTGACCAAGTCCGAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003456.1-991s1c1
Sequence:CCGGCGTCCCGGAGAAGCCCAACGACTCGAGTCGTTGGGCTTCTCCGGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003456.1-1678s1c1
Sequence:CCGGCCCGTTGTGTGGCAAGAGCTTCTCGAGAAGCTCTTGCCACACAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003456.1-505s1c1
Sequence:CCGGCCTCACTGCCTGGTCCCAGATCTCGAGATCTGGGACCAGGCAGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks