EMAIL THIS PAGE TO A FRIEND

ZNF207

zinc finger protein 207

Gene ID:
chicken(417413) zinc finger protein 207
dog(480611) zinc finger protein 207
Horse(100058395) zinc finger protein 207
domestic cat(101090813) zinc finger protein 207
domestic guinea pig(100718948) zinc finger protein 207
naked mole-rat(101722555) zinc finger protein 207
cow(505177) zinc finger protein 207
sheep(101121358) zinc finger protein 207
173 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1105799 Anti-ZNF207 (107-118) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1105800 Anti-ZNF207 (446-459) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
GW21240 Anti-ZNF207 antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human, mouse
western blot pricing
SAB1412394 ANTI-ZNF207 antibody produced in mouse clone 6G11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412395 ANTI-ZNF207 antibody produced in mouse clone 6H8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412396 ANTI-ZNF207 antibody produced in mouse clone 8G7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412397 ANTI-ZNF207 antibody produced in mouse clone 7G1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412398 ANTI-ZNF207 antibody produced in mouse clone 5G6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412399 ANTI-ZNF207 antibody produced in mouse clone 5G3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412400 ANTI-ZNF207 antibody produced in mouse clone 1A2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA017013 Anti-ZNF207 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
AV33553 Anti-ZNF207 antibody produced in rabbit IgG fraction of antiserum horse, human, canine, mouse, bovine, rat, guinea pig, rabbit
western blot pricing
SAB2102819 Anti-ZNF207 antibody produced in rabbit affinity isolated antibody bovine, guinea pig, zebrafish, canine, rat, mouse, horse, rabbit, human
western blot pricing
HPA063908 Anti-ZNF207 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
WH0007756M1 Monoclonal Anti-ZNF207 antibody produced in mouse clone 6D6, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, western blot pricing
SAB1404553 Monoclonal Anti-ZNF207, (N-terminal) antibody produced in mouse clone 6D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003457 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003457 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003457 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU061721 MISSION® esiRNA esiRNA human ZNF207 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032293 Rosetta Predictions human pricing
NM_001098507 Rosetta Predictions human pricing
NM_003457 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032293 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307878 predicted 309
2 SASI_Hs02_00307879 predicted 257
3 SASI_Hs01_00168940 predicted 1376
4 SASI_Hs02_00307880 predicted 1540
5 SASI_Hs01_00168941 predicted 1203
6 SASI_Hs01_00168942 predicted 1186
7 SASI_Hs02_00307881 predicted 1490
8 SASI_Hs02_00307882 predicted 1492
9 SASI_Hs01_00168945 predicted 1231
10 SASI_Hs01_00168946 predicted 1374
11 SASI_Hs01_00168943 predicted 1591
12 SASI_Hs01_00168944 predicted 415
13 SASI_Hs01_00168947 predicted 1538
14 SASI_Hs01_00168948 predicted 1534
15 SASI_Hs01_00168949 predicted 1625
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319147 predicted 306
2 SASI_Hs02_00319148 predicted 252
3 SASI_Hs02_00319149 predicted 1471
4 SASI_Hs02_00319150 predicted 1631
5 SASI_Hs02_00319151 predicted 1292
6 SASI_Hs02_00319152 predicted 1277
7 SASI_Hs02_00319153 predicted 1582
8 SASI_Hs02_00319154 predicted 1591
9 SASI_Hs02_00319155 predicted 1327
10 SASI_Hs02_00319156 predicted 1473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335699 predicted 312
2 SASI_Hs02_00335700 predicted 248
3 SASI_Hs01_00013734 predicted 1419
4 SASI_Hs02_00335701 predicted 1579
5 SASI_Hs01_00013735 predicted 1249
6 SASI_Hs01_00013736 predicted 1230
7 SASI_Hs02_00335702 predicted 1540
8 SASI_Hs02_00335703 predicted 1540
9 SASI_Hs01_00013739 predicted 1273
10 SASI_Hs01_00013740 predicted 1419
11 SASI_Hs01_00013737 predicted 1684
12 SASI_Hs01_00013738 predicted 468
13 SASI_Hs01_00013741 predicted 1634
14 SASI_Hs01_00013742 predicted 1630
15 SASI_Hs01_00013743 predicted 1729
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003457
VALIDATED
ZNF207 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 207
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_003457.1-1928s1c1
Sequence:CCGGCGCTGGAATTACATGAACATACTCGAGTATGTTCATGTAATTCCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003457.1-482s1c1
Sequence:CCGGCGACGACTTCTTGAACAGAAACTCGAGTTTCTGTTCAAGAAGTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003457.1-1277s1c1
Sequence:CCGGGCAACCAGTAAGTTGATCCATCTCGAGATGGATCAACTTACTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003457.1-607s1c1
Sequence:CCGGGCAAGGTTATATTCCTCCAATCTCGAGATTGGAGGAATATAACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_003457.3-1648s21c1
Sequence:CCGGATAGCCAAGCTTCCGTCAATACTCGAGTATTGACGGAAGCTTGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003457.3-428s21c1
Sequence:CCGGCGACGACTTCTTGAACAGAAACTCGAGTTTCTGTTCAAGAAGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003457.3-1104s21c1
Sequence:CCGGAGCCTACATTCCCTGCTTATACTCGAGTATAAGCAGGGAATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003457.3-1283s21c1
Sequence:CCGGTTACCTAAGTATCAACGTAATCTCGAGATTACGTTGATACTTAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003457.3-208s21c1
Sequence:CCGGTGATGATGAGAAGATCCTTATCTCGAGATAAGGATCTTCTCATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003457
VALIDATED
ZNF207 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 207
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_003457.1-1928s1c1
Sequence:CCGGCGCTGGAATTACATGAACATACTCGAGTATGTTCATGTAATTCCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003457.1-482s1c1
Sequence:CCGGCGACGACTTCTTGAACAGAAACTCGAGTTTCTGTTCAAGAAGTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003457.1-1277s1c1
Sequence:CCGGGCAACCAGTAAGTTGATCCATCTCGAGATGGATCAACTTACTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003457.1-607s1c1
Sequence:CCGGGCAAGGTTATATTCCTCCAATCTCGAGATTGGAGGAATATAACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_003457.3-1648s21c1
Sequence:CCGGATAGCCAAGCTTCCGTCAATACTCGAGTATTGACGGAAGCTTGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003457.3-428s21c1
Sequence:CCGGCGACGACTTCTTGAACAGAAACTCGAGTTTCTGTTCAAGAAGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003457.3-1104s21c1
Sequence:CCGGAGCCTACATTCCCTGCTTATACTCGAGTATAAGCAGGGAATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003457.3-1283s21c1
Sequence:CCGGTTACCTAAGTATCAACGTAATCTCGAGATTACGTTGATACTTAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003457.3-208s21c1
Sequence:CCGGTGATGATGAGAAGATCCTTATCTCGAGATAAGGATCTTCTCATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003457
VALIDATED
ZNF207 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 207
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013033    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_003457.1-1928s1c1
Sequence:CCGGCGCTGGAATTACATGAACATACTCGAGTATGTTCATGTAATTCCAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_003457.1-482s1c1
Sequence:CCGGCGACGACTTCTTGAACAGAAACTCGAGTTTCTGTTCAAGAAGTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003457.1-1277s1c1
Sequence:CCGGGCAACCAGTAAGTTGATCCATCTCGAGATGGATCAACTTACTGGTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_003457.1-607s1c1
Sequence:CCGGGCAAGGTTATATTCCTCCAATCTCGAGATTGGAGGAATATAACCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285164    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_003457.3-1648s21c1
Sequence:CCGGATAGCCAAGCTTCCGTCAATACTCGAGTATTGACGGAAGCTTGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_003457.3-428s21c1
Sequence:CCGGCGACGACTTCTTGAACAGAAACTCGAGTTTCTGTTCAAGAAGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003457.3-1104s21c1
Sequence:CCGGAGCCTACATTCCCTGCTTATACTCGAGTATAAGCAGGGAATGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003457.3-1283s21c1
Sequence:CCGGTTACCTAAGTATCAACGTAATCTCGAGATTACGTTGATACTTAGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_003457.3-208s21c1
Sequence:CCGGTGATGATGAGAAGATCCTTATCTCGAGATAAGGATCTTCTCATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks