EMAIL THIS PAGE TO A FRIEND

ZNF208

zinc finger protein 208

Synonyms: PMIDP ZNF95
UniProtKB ID: O43345
Gene ID:
Human(7757) Summary: Zinc finger proteins (ZNFs), such as ZNF208, bind DNA and, through this binding, regulate gene transcription. Most ZNFs contain conserved C2H2 motifs and are classified as Kruppel-type zinc fingers. A conserved protein motif, termed the Kruppel-associated box (KRAB) domain, mediates protein-protein interactions (Eichler et al., 1998 [PubMed 9724325]
dog(403422) zinc finger protein 208
naked mole-rat(101728995) zinc finger protein 208
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007153 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007153 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00343063 predicted 3552
2 SASI_Hs01_00167787 predicted 791
3 SASI_Hs01_00167788 predicted 3294
4 SASI_Hs02_00343064 predicted 3547
5 SASI_Hs01_00167794 predicted 1381
6 SASI_Hs02_00343065 predicted 3555
7 SASI_Hs01_00167791 predicted 1613
8 SASI_Hs01_00167792 predicted 1613
9 SASI_Hs01_00167793 predicted 2041
10 SASI_Hs02_00343066 predicted 2625
11 SASI_Hs01_00167786 predicted 417
12 SASI_Hs01_00167789 predicted 449
13 SASI_Hs01_00167790 predicted 2657
14 SASI_Hs01_00167795 predicted 443
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007153
ZNF208 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 208
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007153.3-1292s21c1
Sequence:CCGGCTCAACCCTTAGTTATCATAACTCGAGTTATGATAACTAAGGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007153.3-4280s21c1
Sequence:CCGGCTCAACCCTCAGTTATCATAGCTCGAGCTATGATAACTGAGGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007153.3-1921s21c1
Sequence:CCGGACCAATCTGCAATTCTTATTACTCGAGTAATAAGAATTGCAGATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007153.1-2061s1c1
Sequence:CCGGCCGATCTGCAATCCTTATTAACTCGAGTTAATAAGGATTGCAGATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007153.1-222s1c1
Sequence:CCGGCCCAGTTATATGTTCTCATTTCTCGAGAAATGAGAACATATAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007153.1-980s1c1
Sequence:CCGGCCCTTATTACACATAAGGCAACTCGAGTTGCCTTATGTGTAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007153.1-3069s1c1
Sequence:CCGGGTGGTCCTCAACCCTTAGTTACTCGAGTAACTAAGGGTTGAGGACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007153.1-2646s1c1
Sequence:CCGGCAACTGGTCATCAAACCTTATCTCGAGATAAGGTTTGATGACCAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007153
ZNF208 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 208
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007153.3-1292s21c1
Sequence:CCGGCTCAACCCTTAGTTATCATAACTCGAGTTATGATAACTAAGGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007153.3-4280s21c1
Sequence:CCGGCTCAACCCTCAGTTATCATAGCTCGAGCTATGATAACTGAGGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007153.3-1921s21c1
Sequence:CCGGACCAATCTGCAATTCTTATTACTCGAGTAATAAGAATTGCAGATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007153.1-2061s1c1
Sequence:CCGGCCGATCTGCAATCCTTATTAACTCGAGTTAATAAGGATTGCAGATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007153.1-222s1c1
Sequence:CCGGCCCAGTTATATGTTCTCATTTCTCGAGAAATGAGAACATATAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007153.1-980s1c1
Sequence:CCGGCCCTTATTACACATAAGGCAACTCGAGTTGCCTTATGTGTAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007153.1-3069s1c1
Sequence:CCGGGTGGTCCTCAACCCTTAGTTACTCGAGTAACTAAGGGTTGAGGACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007153.1-2646s1c1
Sequence:CCGGCAACTGGTCATCAAACCTTATCTCGAGATAAGGTTTGATGACCAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007153
ZNF208 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 208
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436623    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007153.3-1292s21c1
Sequence:CCGGCTCAACCCTTAGTTATCATAACTCGAGTTATGATAACTAAGGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433321    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007153.3-4280s21c1
Sequence:CCGGCTCAACCCTCAGTTATCATAGCTCGAGCTATGATAACTGAGGGTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007153.3-1921s21c1
Sequence:CCGGACCAATCTGCAATTCTTATTACTCGAGTAATAAGAATTGCAGATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007153.1-2061s1c1
Sequence:CCGGCCGATCTGCAATCCTTATTAACTCGAGTTAATAAGGATTGCAGATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007153.1-222s1c1
Sequence:CCGGCCCAGTTATATGTTCTCATTTCTCGAGAAATGAGAACATATAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007153.1-980s1c1
Sequence:CCGGCCCTTATTACACATAAGGCAACTCGAGTTGCCTTATGTGTAATAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007153.1-3069s1c1
Sequence:CCGGGTGGTCCTCAACCCTTAGTTACTCGAGTAACTAAGGGTTGAGGACCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007153.1-2646s1c1
Sequence:CCGGCAACTGGTCATCAAACCTTATCTCGAGATAAGGTTTGATGACCAGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks