EMAIL THIS PAGE TO A FRIEND

ZNF20

zinc finger protein 20

Synonyms: KOX13
Species: Human ZNF20(7568)
UniProtKB ID: P17024, Q8N457, Q9UG41
Gene ID:
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021143 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021143 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021143 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021143 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354668 predicted 1681
2 SASI_Hs01_00027857 predicted 593
3 SASI_Hs01_00027858 predicted 435
4 SASI_Hs01_00027859 predicted 395
5 SASI_Hs01_00027860 predicted 406
6 SASI_Hs02_00354669 predicted 533
7 SASI_Hs01_00027856 predicted 617
8 SASI_Hs02_00354670 predicted 893
9 SASI_Hs01_00027862 predicted 1225
10 SASI_Hs01_00027863 predicted 1025
11 SASI_Hs01_00027861 predicted 922
12 SASI_Hs01_00027864 predicted 1693
13 SASI_Hs01_00027865 predicted 310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021143
ZNF20 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 20
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021143.1-2009s1c1
Sequence:CCGGCCTGATTCTTTGGCTTGTTAACTCGAGTTAACAAGCCAAAGAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021143.1-1174s1c1
Sequence:CCGGCGGACCTTCAAAGGCATGAAACTCGAGTTTCATGCCTTTGAAGGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021143.1-868s1c1
Sequence:CCGGCAGGAGTGAATGCCGATGAATCTCGAGATTCATCGGCATTCACTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021143.1-418s1c1
Sequence:CCGGCTGGAATAACACCATGTGAAACTCGAGTTTCACATGGTGTTATTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021143.1-460s1c1
Sequence:CCGGGCACGGGTCATTCATCTCTTACTCGAGTAAGAGATGAATGACCCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021143.2-944s21c1
Sequence:CCGGTAGTGAAATTCGTAGACATAACTCGAGTTATGTCTACGAATTTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021143.2-1028s21c1
Sequence:CCGGCAGTTCCATTCAGTATCATAACTCGAGTTATGATACTGAATGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021143.2-1609s21c1
Sequence:CCGGTTTCCAATTACATTCGATATCCTCGAGGATATCGAATGTAATTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021143.2-893s21c1
Sequence:CCGGAGGAGTGAATGCCGATGAATGCTCGAGCATTCATCGGCATTCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021143.2-1892s21c1
Sequence:CCGGACTTGGATGGTTTCGTAATACCTCGAGGTATTACGAAACCATCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021143
ZNF20 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 20
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021143.1-2009s1c1
Sequence:CCGGCCTGATTCTTTGGCTTGTTAACTCGAGTTAACAAGCCAAAGAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021143.1-1174s1c1
Sequence:CCGGCGGACCTTCAAAGGCATGAAACTCGAGTTTCATGCCTTTGAAGGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021143.1-868s1c1
Sequence:CCGGCAGGAGTGAATGCCGATGAATCTCGAGATTCATCGGCATTCACTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021143.1-418s1c1
Sequence:CCGGCTGGAATAACACCATGTGAAACTCGAGTTTCACATGGTGTTATTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021143.1-460s1c1
Sequence:CCGGGCACGGGTCATTCATCTCTTACTCGAGTAAGAGATGAATGACCCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021143.2-944s21c1
Sequence:CCGGTAGTGAAATTCGTAGACATAACTCGAGTTATGTCTACGAATTTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021143.2-1028s21c1
Sequence:CCGGCAGTTCCATTCAGTATCATAACTCGAGTTATGATACTGAATGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021143.2-1609s21c1
Sequence:CCGGTTTCCAATTACATTCGATATCCTCGAGGATATCGAATGTAATTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021143.2-893s21c1
Sequence:CCGGAGGAGTGAATGCCGATGAATGCTCGAGCATTCATCGGCATTCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021143.2-1892s21c1
Sequence:CCGGACTTGGATGGTTTCGTAATACCTCGAGGTATTACGAAACCATCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021143
ZNF20 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 20
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014808    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021143.1-2009s1c1
Sequence:CCGGCCTGATTCTTTGGCTTGTTAACTCGAGTTAACAAGCCAAAGAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021143.1-1174s1c1
Sequence:CCGGCGGACCTTCAAAGGCATGAAACTCGAGTTTCATGCCTTTGAAGGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021143.1-868s1c1
Sequence:CCGGCAGGAGTGAATGCCGATGAATCTCGAGATTCATCGGCATTCACTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021143.1-418s1c1
Sequence:CCGGCTGGAATAACACCATGTGAAACTCGAGTTTCACATGGTGTTATTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021143.1-460s1c1
Sequence:CCGGGCACGGGTCATTCATCTCTTACTCGAGTAAGAGATGAATGACCCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021143.2-944s21c1
Sequence:CCGGTAGTGAAATTCGTAGACATAACTCGAGTTATGTCTACGAATTTCACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021143.2-1028s21c1
Sequence:CCGGCAGTTCCATTCAGTATCATAACTCGAGTTATGATACTGAATGGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021143.2-1609s21c1
Sequence:CCGGTTTCCAATTACATTCGATATCCTCGAGGATATCGAATGTAATTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021143.2-893s21c1
Sequence:CCGGAGGAGTGAATGCCGATGAATGCTCGAGCATTCATCGGCATTCACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235719    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021143.2-1892s21c1
Sequence:CCGGACTTGGATGGTTTCGTAATACCTCGAGGTATTACGAAACCATCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks