EMAIL THIS PAGE TO A FRIEND

ZNF211

zinc finger protein 211

Synonyms: C2H2-25 CH2H2-25 ZNF-25 ZNFC25
Gene ID:
dog(610960) zinc finger protein 211
Horse(100062419) zinc finger protein 211
naked mole-rat(101706607) zinc finger protein 211
domestic guinea pig(100719824) zinc finger protein 211
cow(789989) zinc finger protein 211
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006385 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006385 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006385 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065931 MISSION® esiRNA esiRNA human ZNF211 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006385 Rosetta Predictions human pricing
NM_198855 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006385 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341457 predicted 1058
2 SASI_Hs01_00016305 predicted 1479
3 SASI_Hs01_00016306 predicted 973
4 SASI_Hs01_00016307 predicted 594
5 SASI_Hs01_00016308 predicted 1122
6 SASI_Hs01_00016309 predicted 764
7 SASI_Hs01_00016310 predicted 874
8 SASI_Hs01_00016312 predicted 1623
9 SASI_Hs01_00016313 predicted 865
10 SASI_Hs01_00016314 predicted 920
11 SASI_Hs01_00016311 predicted 1567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372371 predicted 1022
2 SASI_Hs01_00010151 predicted 1447
3 SASI_Hs01_00010152 predicted 931
4 SASI_Hs01_00010153 predicted 553
5 SASI_Hs01_00010154 predicted 1087
6 SASI_Hs01_00010155 predicted 725
7 SASI_Hs01_00010156 predicted 838
8 SASI_Hs01_00010158 predicted 1581
9 SASI_Hs01_00010159 predicted 828
10 SASI_Hs01_00010160 predicted 879
11 SASI_Hs01_00010157 predicted 1535
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006385
ZNF211 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 211
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006385.2-1282s1c1
Sequence:CCGGGCAGCGAATGTGGGAAATCTTCTCGAGAAGATTTCCCACATTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006385.2-638s1c1
Sequence:CCGGGCACATTACAGAGGCACCTTTCTCGAGAAAGGTGCCTCTGTAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006385.2-517s1c1
Sequence:CCGGGCCTGGTCTTGAGAGATATTTCTCGAGAAATATCTCTCAAGACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006385.2-2131s1c1
Sequence:CCGGCCACACAGTGTGTATCATTTACTCGAGTAAATGATACACACTGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006385.2-1642s1c1
Sequence:CCGGGCTGTAAATCTAACCTCATTACTCGAGTAATGAGGTTAGATTTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006385.2-517s21c1
Sequence:CCGGGCCTGGTCTTGAGAGATATTTCTCGAGAAATATCTCTCAAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006385.2-1558s21c1
Sequence:CCGGGCCATAGCTCCAACCTTAAGACTCGAGTCTTAAGGTTGGAGCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006385.2-1486s21c1
Sequence:CCGGGCTTCAGTTCACATCGGAAAGCTCGAGCTTTCCGATGTGAACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006385.2-599s21c1
Sequence:CCGGATTCTACATCAGTGCAAATCTCTCGAGAGATTTGCACTGATGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006385
ZNF211 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 211
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006385.2-1282s1c1
Sequence:CCGGGCAGCGAATGTGGGAAATCTTCTCGAGAAGATTTCCCACATTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006385.2-638s1c1
Sequence:CCGGGCACATTACAGAGGCACCTTTCTCGAGAAAGGTGCCTCTGTAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006385.2-517s1c1
Sequence:CCGGGCCTGGTCTTGAGAGATATTTCTCGAGAAATATCTCTCAAGACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006385.2-2131s1c1
Sequence:CCGGCCACACAGTGTGTATCATTTACTCGAGTAAATGATACACACTGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006385.2-1642s1c1
Sequence:CCGGGCTGTAAATCTAACCTCATTACTCGAGTAATGAGGTTAGATTTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006385.2-517s21c1
Sequence:CCGGGCCTGGTCTTGAGAGATATTTCTCGAGAAATATCTCTCAAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006385.2-1558s21c1
Sequence:CCGGGCCATAGCTCCAACCTTAAGACTCGAGTCTTAAGGTTGGAGCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006385.2-1486s21c1
Sequence:CCGGGCTTCAGTTCACATCGGAAAGCTCGAGCTTTCCGATGTGAACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006385.2-599s21c1
Sequence:CCGGATTCTACATCAGTGCAAATCTCTCGAGAGATTTGCACTGATGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006385
ZNF211 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 211
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006385.2-1282s1c1
Sequence:CCGGGCAGCGAATGTGGGAAATCTTCTCGAGAAGATTTCCCACATTCGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006385.2-638s1c1
Sequence:CCGGGCACATTACAGAGGCACCTTTCTCGAGAAAGGTGCCTCTGTAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006385.2-517s1c1
Sequence:CCGGGCCTGGTCTTGAGAGATATTTCTCGAGAAATATCTCTCAAGACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020969    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006385.2-2131s1c1
Sequence:CCGGCCACACAGTGTGTATCATTTACTCGAGTAAATGATACACACTGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006385.2-1642s1c1
Sequence:CCGGGCTGTAAATCTAACCTCATTACTCGAGTAATGAGGTTAGATTTACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006385.2-517s21c1
Sequence:CCGGGCCTGGTCTTGAGAGATATTTCTCGAGAAATATCTCTCAAGACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006385.2-1558s21c1
Sequence:CCGGGCCATAGCTCCAACCTTAAGACTCGAGTCTTAAGGTTGGAGCTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006385.2-1486s21c1
Sequence:CCGGGCTTCAGTTCACATCGGAAAGCTCGAGCTTTCCGATGTGAACTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006385.2-599s21c1
Sequence:CCGGATTCTACATCAGTGCAAATCTCTCGAGAGATTTGCACTGATGTAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks