EMAIL THIS PAGE TO A FRIEND

ZNF213

zinc finger protein 213

Synonyms: CR53 ZKSCAN21 ZSCAN53
UniProtKB ID: O14771, A8K1B9, Q96IS1
Gene ID:
Human(7760) Summary: C2H2 zinc finger proteins, such as ZNF213, have bipartite structures in which one domain binds DNA or RNA and the other modulates target gene expression.[supplied by OMIM, Apr 2004]
Horse(100065918) zinc finger protein 213
dog(100688079) zinc finger protein 213
domestic cat(101098185) zinc finger protein 213
naked mole-rat(101699796) zinc finger protein 213
domestic guinea pig(100715363) zinc finger protein 213
cow(101902686) zinc finger protein 213
sheep(101120542) zinc finger protein 213
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004220 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004220 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004220 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135791 MISSION® esiRNA esiRNA human ZNF213 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004220 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004220 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106967 predicted 1030
2 SASI_Hs01_00106968 predicted 1471
3 SASI_Hs01_00106969 predicted 970
4 SASI_Hs01_00106970 predicted 2163
5 SASI_Hs01_00106971 predicted 738
6 SASI_Hs02_00337133 predicted 985
7 SASI_Hs01_00106972 predicted 1590
8 SASI_Hs01_00106973 predicted 2089
9 SASI_Hs01_00106974 predicted 978
10 SASI_Hs01_00106975 predicted 752
11 SASI_Hs01_00106966 predicted 1034
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004220
VALIDATED
ZNF213 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 213
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_004220.1-2707s1c1
Sequence:CCGGGCACTAATGCTCCACTCCATTCTCGAGAATGGAGTGGAGCATTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004220.1-897s1c1
Sequence:CCGGCCTGCTCTTCTTAAAGAGGGTCTCGAGACCCTCTTTAAGAAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004220.1-1602s1c1
Sequence:CCGGCGCTCCTACCTGCTGGACCATCTCGAGATGGTCCAGCAGGTAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004220.1-976s1c1
Sequence:CCGGTGGGAGACATCCCATTCTATTCTCGAGAATAGAATGGGATGTCTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_004220.1-417s1c1
Sequence:CCGGCTTCTGATTGTGAAAGTGGAACTCGAGTTCCACTTTCACAATCAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004220.2-538s21c1
Sequence:CCGGGAATCTGCCCAGCATGAGGATCTCGAGATCCTCATGCTGGGCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004220.2-1185s21c1
Sequence:CCGGCCAAAGTGAGAAGTCCCTGCTCTCGAGAGCAGGGACTTCTCACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004220.2-1039s21c1
Sequence:CCGGGTCCATGGACCTGTGGCATTGCTCGAGCAATGCCACAGGTCCATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004220.2-610s21c1
Sequence:CCGGGATGTGCATGGGCCTCATGAGCTCGAGCTCATGAGGCCCATGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004220
VALIDATED
ZNF213 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 213
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_004220.1-2707s1c1
Sequence:CCGGGCACTAATGCTCCACTCCATTCTCGAGAATGGAGTGGAGCATTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004220.1-897s1c1
Sequence:CCGGCCTGCTCTTCTTAAAGAGGGTCTCGAGACCCTCTTTAAGAAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004220.1-1602s1c1
Sequence:CCGGCGCTCCTACCTGCTGGACCATCTCGAGATGGTCCAGCAGGTAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004220.1-976s1c1
Sequence:CCGGTGGGAGACATCCCATTCTATTCTCGAGAATAGAATGGGATGTCTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_004220.1-417s1c1
Sequence:CCGGCTTCTGATTGTGAAAGTGGAACTCGAGTTCCACTTTCACAATCAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004220.2-538s21c1
Sequence:CCGGGAATCTGCCCAGCATGAGGATCTCGAGATCCTCATGCTGGGCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004220.2-1185s21c1
Sequence:CCGGCCAAAGTGAGAAGTCCCTGCTCTCGAGAGCAGGGACTTCTCACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004220.2-1039s21c1
Sequence:CCGGGTCCATGGACCTGTGGCATTGCTCGAGCAATGCCACAGGTCCATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004220.2-610s21c1
Sequence:CCGGGATGTGCATGGGCCTCATGAGCTCGAGCTCATGAGGCCCATGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004220
VALIDATED
ZNF213 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 213
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013043    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_004220.1-2707s1c1
Sequence:CCGGGCACTAATGCTCCACTCCATTCTCGAGAATGGAGTGGAGCATTAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004220.1-897s1c1
Sequence:CCGGCCTGCTCTTCTTAAAGAGGGTCTCGAGACCCTCTTTAAGAAGAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004220.1-1602s1c1
Sequence:CCGGCGCTCCTACCTGCTGGACCATCTCGAGATGGTCCAGCAGGTAGGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004220.1-976s1c1
Sequence:CCGGTGGGAGACATCCCATTCTATTCTCGAGAATAGAATGGGATGTCTCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A3
TRC Version: 1 Clone ID:NM_004220.1-417s1c1
Sequence:CCGGCTTCTGATTGTGAAAGTGGAACTCGAGTTCCACTTTCACAATCAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004220.2-538s21c1
Sequence:CCGGGAATCTGCCCAGCATGAGGATCTCGAGATCCTCATGCTGGGCAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004220.2-1185s21c1
Sequence:CCGGCCAAAGTGAGAAGTCCCTGCTCTCGAGAGCAGGGACTTCTCACTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417598    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004220.2-1039s21c1
Sequence:CCGGGTCCATGGACCTGTGGCATTGCTCGAGCAATGCCACAGGTCCATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004220.2-610s21c1
Sequence:CCGGGATGTGCATGGGCCTCATGAGCTCGAGCTCATGAGGCCCATGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks