EMAIL THIS PAGE TO A FRIEND

ZNF214

zinc finger protein 214

Synonyms: BAZ-1 BAZ1
UniProtKB ID: Q9UL59, B2R8Q1
Gene ID:
cow(100140999) zinc finger protein 214
sheep(101112760) zinc finger protein 214
naked mole-rat(101701091) zinc finger protein 214
Domestic Rabbit(100342937) zinc finger protein 214
dog(485363) zinc finger protein 214
Horse(100070494) zinc finger protein 214
domestic cat(101096010) zinc finger protein 214
23 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013249 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013249 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013249 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU155511 MISSION® esiRNA esiRNA human ZNF214 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013249 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013249 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246064 predicted 1199
2 SASI_Hs01_00246067 predicted 2155
3 SASI_Hs01_00246068 predicted 630
4 SASI_Hs01_00246069 predicted 406
5 SASI_Hs01_00246070 predicted 1099
6 SASI_Hs01_00246071 predicted 1881
7 SASI_Hs01_00246072 predicted 1243
8 SASI_Hs01_00246073 predicted 643
9 SASI_Hs02_00344461 predicted 374
10 SASI_Hs02_00344462 predicted 587
11 SASI_Hs01_00246065 predicted 993
12 SASI_Hs01_00246066 predicted 811
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013249
ZNF214 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 214
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013249.2-855s21c1
Sequence:CCGGCATAGTTCAGCATTCTTATATCTCGAGATATAAGAATGCTGAACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013249.2-2248s21c1
Sequence:CCGGCTATCTCCCACTAAGAATTATCTCGAGATAATTCTTAGTGGGAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013249.2-953s21c1
Sequence:CCGGAGTACTGTGGATGTAATAAATCTCGAGATTTATTACATCCACAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013249.1-2010s1c1
Sequence:CCGGCCGTGAATATTATAAGGGATTCTCGAGAATCCCTTATAATATTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013249.1-698s1c1
Sequence:CCGGCTCAAGACTATGGTAGAGAAACTCGAGTTTCTCTACCATAGTCTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013249.1-2141s1c1
Sequence:CCGGCCTGCTGTTAAGGAAATCTTACTCGAGTAAGATTTCCTTAACAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013249.1-1786s1c1
Sequence:CCGGCGTTCACATCTTCTCATTCATCTCGAGATGAATGAGAAGATGTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013249.1-1534s1c1
Sequence:CCGGCGCTCAAATCTTCAAATTCATCTCGAGATGAATTTGAAGATTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013249
ZNF214 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 214
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013249.2-855s21c1
Sequence:CCGGCATAGTTCAGCATTCTTATATCTCGAGATATAAGAATGCTGAACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013249.2-2248s21c1
Sequence:CCGGCTATCTCCCACTAAGAATTATCTCGAGATAATTCTTAGTGGGAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013249.2-953s21c1
Sequence:CCGGAGTACTGTGGATGTAATAAATCTCGAGATTTATTACATCCACAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013249.1-2010s1c1
Sequence:CCGGCCGTGAATATTATAAGGGATTCTCGAGAATCCCTTATAATATTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013249.1-698s1c1
Sequence:CCGGCTCAAGACTATGGTAGAGAAACTCGAGTTTCTCTACCATAGTCTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013249.1-2141s1c1
Sequence:CCGGCCTGCTGTTAAGGAAATCTTACTCGAGTAAGATTTCCTTAACAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013249.1-1786s1c1
Sequence:CCGGCGTTCACATCTTCTCATTCATCTCGAGATGAATGAGAAGATGTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013249.1-1534s1c1
Sequence:CCGGCGCTCAAATCTTCAAATTCATCTCGAGATGAATTTGAAGATTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013249
ZNF214 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 214
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013249.2-855s21c1
Sequence:CCGGCATAGTTCAGCATTCTTATATCTCGAGATATAAGAATGCTGAACTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426768    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013249.2-2248s21c1
Sequence:CCGGCTATCTCCCACTAAGAATTATCTCGAGATAATTCTTAGTGGGAGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013249.2-953s21c1
Sequence:CCGGAGTACTGTGGATGTAATAAATCTCGAGATTTATTACATCCACAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013249.1-2010s1c1
Sequence:CCGGCCGTGAATATTATAAGGGATTCTCGAGAATCCCTTATAATATTCACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013249.1-698s1c1
Sequence:CCGGCTCAAGACTATGGTAGAGAAACTCGAGTTTCTCTACCATAGTCTTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013249.1-2141s1c1
Sequence:CCGGCCTGCTGTTAAGGAAATCTTACTCGAGTAAGATTTCCTTAACAGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013249.1-1786s1c1
Sequence:CCGGCGTTCACATCTTCTCATTCATCTCGAGATGAATGAGAAGATGTGAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013249.1-1534s1c1
Sequence:CCGGCGCTCAAATCTTCAAATTCATCTCGAGATGAATTTGAAGATTTGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks