EMAIL THIS PAGE TO A FRIEND

ZNF217

zinc finger protein 217

Synonyms: ZABC1
UniProtKB ID: O75362, E1P5Y6, Q14DB8
Gene ID:
cow(507766) zinc finger protein 217
sheep(101120514) zinc finger protein 217
naked mole-rat(101718047) zinc finger protein 217
domestic guinea pig(100721765) zinc finger protein 217
Zebrafish(323822) zinc finger protein 217
domestic cat(101096384) zinc finger protein 217
dog(485934) zinc finger protein 217
chicken(419340) zinc finger protein 217
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006526 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069231 MISSION® esiRNA esiRNA human ZNF217 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006526 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170135 predicted 1617
2 SASI_Hs01_00170136 predicted 288
3 SASI_Hs02_00341762 predicted 3085
4 SASI_Hs01_00170137 predicted 840
5 SASI_Hs01_00170138 predicted 3066
6 SASI_Hs02_00341763 predicted 3384
7 SASI_Hs01_00170139 predicted 3208
8 SASI_Hs01_00170140 predicted 2390
9 SASI_Hs01_00170141 predicted 2673
10 SASI_Hs01_00170142 predicted 2713
11 SASI_Hs01_00170143 predicted 3379
12 SASI_Hs01_00170144 predicted 1802
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006526
VALIDATED
ZNF217 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 217
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-494s21c1
Sequence:CCGGACACATTCAGAAGACCTTAATCTCGAGATTAAGGTCTTCTGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-2951s21c1
Sequence:CCGGCCTCCGGGAAGAGACTATTTCCTCGAGGAAATAGTCTCTTCCCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-2454s21c1
Sequence:CCGGACCAGAGACTGGAGCATAAATCTCGAGATTTATGCTCCAGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-3323s21c1
Sequence:CCGGTCATATCAACACTTATCTAACCTCGAGGTTAGATAAGTGTTGATATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006526.2-3841s21c1
Sequence:CCGGTGTAAACCTGCTTGTTCAAATCTCGAGATTTGAACAAGCAGGTTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-2194s21c1
Sequence:CCGGTAGAACCAAGGCGGATGTTACCTCGAGGTAACATCCGCCTTGGTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-1892s21c1
Sequence:CCGGGACACTGAAGATGCACTATTACTCGAGTAATAGTGCATCTTCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006526.2-3990s1c1
Sequence:CCGGCCCAAATCTATTGTTGTCTTACTCGAGTAAGACAACAATAGATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006526.2-3071s1c1
Sequence:CCGGGCCAATTACAGAAGAGGCTATCTCGAGATAGCCTCTTCTGTAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006526.2-2363s1c1
Sequence:CCGGCCGGCAATTTCTTTGAGTAAACTCGAGTTTACTCAAAGAAATTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006526.2-298s1c1
Sequence:CCGGGCCAACTCAATCCCTCTTAATCTCGAGATTAAGAGGGATTGAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006526.2-673s1c1
Sequence:CCGGGCAGACATTTAGAGTCGCTTTCTCGAGAAAGCGACTCTAAATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006526
VALIDATED
ZNF217 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 217
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-494s21c1
Sequence:CCGGACACATTCAGAAGACCTTAATCTCGAGATTAAGGTCTTCTGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-2951s21c1
Sequence:CCGGCCTCCGGGAAGAGACTATTTCCTCGAGGAAATAGTCTCTTCCCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-2454s21c1
Sequence:CCGGACCAGAGACTGGAGCATAAATCTCGAGATTTATGCTCCAGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-3323s21c1
Sequence:CCGGTCATATCAACACTTATCTAACCTCGAGGTTAGATAAGTGTTGATATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006526.2-3841s21c1
Sequence:CCGGTGTAAACCTGCTTGTTCAAATCTCGAGATTTGAACAAGCAGGTTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-2194s21c1
Sequence:CCGGTAGAACCAAGGCGGATGTTACCTCGAGGTAACATCCGCCTTGGTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-1892s21c1
Sequence:CCGGGACACTGAAGATGCACTATTACTCGAGTAATAGTGCATCTTCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006526.2-3990s1c1
Sequence:CCGGCCCAAATCTATTGTTGTCTTACTCGAGTAAGACAACAATAGATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006526.2-3071s1c1
Sequence:CCGGGCCAATTACAGAAGAGGCTATCTCGAGATAGCCTCTTCTGTAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006526.2-2363s1c1
Sequence:CCGGCCGGCAATTTCTTTGAGTAAACTCGAGTTTACTCAAAGAAATTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006526.2-298s1c1
Sequence:CCGGGCCAACTCAATCCCTCTTAATCTCGAGATTAAGAGGGATTGAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006526.2-673s1c1
Sequence:CCGGGCAGACATTTAGAGTCGCTTTCTCGAGAAAGCGACTCTAAATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006526
VALIDATED
ZNF217 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 217
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-494s21c1
Sequence:CCGGACACATTCAGAAGACCTTAATCTCGAGATTAAGGTCTTCTGAATGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-2951s21c1
Sequence:CCGGCCTCCGGGAAGAGACTATTTCCTCGAGGAAATAGTCTCTTCCCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-2454s21c1
Sequence:CCGGACCAGAGACTGGAGCATAAATCTCGAGATTTATGCTCCAGTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-3323s21c1
Sequence:CCGGTCATATCAACACTTATCTAACCTCGAGGTTAGATAAGTGTTGATATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364635    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_006526.2-3841s21c1
Sequence:CCGGTGTAAACCTGCTTGTTCAAATCTCGAGATTTGAACAAGCAGGTTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-2194s21c1
Sequence:CCGGTAGAACCAAGGCGGATGTTACCTCGAGGTAACATCCGCCTTGGTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006526.2-1892s21c1
Sequence:CCGGGACACTGAAGATGCACTATTACTCGAGTAATAGTGCATCTTCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006526.2-3990s1c1
Sequence:CCGGCCCAAATCTATTGTTGTCTTACTCGAGTAAGACAACAATAGATTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006526.2-3071s1c1
Sequence:CCGGGCCAATTACAGAAGAGGCTATCTCGAGATAGCCTCTTCTGTAATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006526.2-2363s1c1
Sequence:CCGGCCGGCAATTTCTTTGAGTAAACTCGAGTTTACTCAAAGAAATTGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_006526.2-298s1c1
Sequence:CCGGGCCAACTCAATCCCTCTTAATCTCGAGATTAAGAGGGATTGAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006526.2-673s1c1
Sequence:CCGGGCAGACATTTAGAGTCGCTTTCTCGAGAAAGCGACTCTAAATGTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks