EMAIL THIS PAGE TO A FRIEND

ZNF219

zinc finger protein 219

Synonyms: ZFP219
UniProtKB ID: Q9P2Y4, D3DS16, Q53Y57, Q8IYC1, Q9BW28
Gene ID:
dog(100687980) zinc finger protein 219
domestic cat(101084457) zinc finger protein 219
Horse(100059191) zinc finger protein 219
domestic guinea pig(100719343) zinc finger protein 219
naked mole-rat(101724996) zinc finger protein 219
cow(615493) zinc finger protein 219
sheep(101114707) zinc finger protein 219
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016423 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016423 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016423 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001101672 Rosetta Predictions human pricing
NM_001102454 Rosetta Predictions human pricing
NM_016423 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322923 predicted 2462
2 SASI_Hs02_00322924 predicted 1807
3 SASI_Hs02_00322925 predicted 2501
4 SASI_Hs02_00322926 predicted 2634
5 SASI_Hs02_00322927 predicted 2341
6 SASI_Hs02_00322928 predicted 2639
7 SASI_Hs02_00322929 predicted 650
8 SASI_Hs02_00322930 predicted 663
9 SASI_Hs02_00322931 predicted 2342
10 SASI_Hs02_00322932 predicted 2269
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102454 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323173 predicted 2457
2 SASI_Hs02_00323174 predicted 1797
3 SASI_Hs02_00323175 predicted 2490
4 SASI_Hs02_00323176 predicted 2627
5 SASI_Hs02_00323177 predicted 2324
6 SASI_Hs02_00323178 predicted 2621
7 SASI_Hs02_00323179 predicted 633
8 SASI_Hs02_00323180 predicted 656
9 SASI_Hs02_00323181 predicted 2332
10 SASI_Hs02_00323182 predicted 2254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016423 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143240 predicted 2594
2 SASI_Hs01_00143242 predicted 1941
3 SASI_Hs01_00143243 predicted 2642
4 SASI_Hs01_00143244 predicted 2774
5 SASI_Hs01_00143245 predicted 2467
6 SASI_Hs02_00349447 predicted 2767
7 SASI_Hs01_00143246 predicted 780
8 SASI_Hs01_00143247 predicted 801
9 SASI_Hs02_00349448 predicted 2481
10 SASI_Hs01_00143248 predicted 2401
11 SASI_Hs01_00143241 predicted 1930
12 SASI_Hs01_00143249 predicted 2008
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016423
ZNF219 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 219
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016423.1-1250s1c1
Sequence:CCGGGCCAGAGCTTTACACAGTCTTCTCGAGAAGACTGTGTAAAGCTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016423.1-611s1c1
Sequence:CCGGGCTTCAACTCTATCCTTGCTTCTCGAGAAGCAAGGATAGAGTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016423.1-1843s1c1
Sequence:CCGGGAAGAGAATGGGCTGTTGGTTCTCGAGAACCAACAGCCCATTCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016423.1-1939s1c1
Sequence:CCGGGCACATCACCTCAAAGTGCATCTCGAGATGCACTTTGAGGTGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016423.1-907s1c1
Sequence:CCGGCCCTACTGCAAAGGCAAGTTTCTCGAGAAACTTGCCTTTGCAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016423.2-2605s21c1
Sequence:CCGGCGATTAGCTTAGTGAGCTTACCTCGAGGTAAGCTCACTAAGCTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016423.2-1260s21c1
Sequence:CCGGGCCAGAGCTTTACACAGTCTTCTCGAGAAGACTGTGTAAAGCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016423.2-1944s21c1
Sequence:CCGGGCTCAGCACATCACCTCAAAGCTCGAGCTTTGAGGTGATGTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016423.2-2887s21c1
Sequence:CCGGCCATAGGCGTGAGAGTTTATTCTCGAGAATAAACTCTCACGCCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016423.2-1307s21c1
Sequence:CCGGCACAAGGCCTCCTTCGATCATCTCGAGATGATCGAAGGAGGCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016423.2-614s21c1
Sequence:CCGGCGCTTCCGCTTCAACTCTATCCTCGAGGATAGAGTTGAAGCGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016423
ZNF219 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 219
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016423.1-1250s1c1
Sequence:CCGGGCCAGAGCTTTACACAGTCTTCTCGAGAAGACTGTGTAAAGCTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016423.1-611s1c1
Sequence:CCGGGCTTCAACTCTATCCTTGCTTCTCGAGAAGCAAGGATAGAGTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016423.1-1843s1c1
Sequence:CCGGGAAGAGAATGGGCTGTTGGTTCTCGAGAACCAACAGCCCATTCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016423.1-1939s1c1
Sequence:CCGGGCACATCACCTCAAAGTGCATCTCGAGATGCACTTTGAGGTGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016423.1-907s1c1
Sequence:CCGGCCCTACTGCAAAGGCAAGTTTCTCGAGAAACTTGCCTTTGCAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016423.2-2605s21c1
Sequence:CCGGCGATTAGCTTAGTGAGCTTACCTCGAGGTAAGCTCACTAAGCTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016423.2-1260s21c1
Sequence:CCGGGCCAGAGCTTTACACAGTCTTCTCGAGAAGACTGTGTAAAGCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016423.2-1944s21c1
Sequence:CCGGGCTCAGCACATCACCTCAAAGCTCGAGCTTTGAGGTGATGTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016423.2-2887s21c1
Sequence:CCGGCCATAGGCGTGAGAGTTTATTCTCGAGAATAAACTCTCACGCCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016423.2-1307s21c1
Sequence:CCGGCACAAGGCCTCCTTCGATCATCTCGAGATGATCGAAGGAGGCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016423.2-614s21c1
Sequence:CCGGCGCTTCCGCTTCAACTCTATCCTCGAGGATAGAGTTGAAGCGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016423
ZNF219 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 219
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016423.1-1250s1c1
Sequence:CCGGGCCAGAGCTTTACACAGTCTTCTCGAGAAGACTGTGTAAAGCTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016423.1-611s1c1
Sequence:CCGGGCTTCAACTCTATCCTTGCTTCTCGAGAAGCAAGGATAGAGTTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016423.1-1843s1c1
Sequence:CCGGGAAGAGAATGGGCTGTTGGTTCTCGAGAACCAACAGCCCATTCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016423.1-1939s1c1
Sequence:CCGGGCACATCACCTCAAAGTGCATCTCGAGATGCACTTTGAGGTGATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016423.1-907s1c1
Sequence:CCGGCCCTACTGCAAAGGCAAGTTTCTCGAGAAACTTGCCTTTGCAGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016423.2-2605s21c1
Sequence:CCGGCGATTAGCTTAGTGAGCTTACCTCGAGGTAAGCTCACTAAGCTAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016423.2-1260s21c1
Sequence:CCGGGCCAGAGCTTTACACAGTCTTCTCGAGAAGACTGTGTAAAGCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016423.2-1944s21c1
Sequence:CCGGGCTCAGCACATCACCTCAAAGCTCGAGCTTTGAGGTGATGTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016423.2-2887s21c1
Sequence:CCGGCCATAGGCGTGAGAGTTTATTCTCGAGAATAAACTCTCACGCCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016423.2-1307s21c1
Sequence:CCGGCACAAGGCCTCCTTCGATCATCTCGAGATGATCGAAGGAGGCCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016423.2-614s21c1
Sequence:CCGGCGCTTCCGCTTCAACTCTATCCTCGAGGATAGAGTTGAAGCGGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks