EMAIL THIS PAGE TO A FRIEND

ZNF221

zinc finger protein 221

Species: Human ZNF221(7638)
UniProtKB ID: Q9UK13, B2RAI6, Q2M2H2, Q9P1U8
Gene ID:
24 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013359 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013359 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013359 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013359 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012794 predicted 1266
2 SASI_Hs01_00012795 predicted 557
3 SASI_Hs01_00012797 predicted 785
4 SASI_Hs01_00012800 predicted 595
5 SASI_Hs01_00012801 predicted 1946
6 SASI_Hs01_00012802 predicted 719
7 SASI_Hs02_00344690 predicted 556
8 SASI_Hs02_00344691 predicted 1915
9 SASI_Hs02_00344692 predicted 531
10 SASI_Hs02_00344693 predicted 802
11 SASI_Hs01_00012796 predicted 1089
12 SASI_Hs01_00012798 predicted 861
13 SASI_Hs01_00012799 predicted 532
14 SASI_Hs01_00012803 predicted 1873
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013359
ZNF221 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 221
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013359.1-2258s1c1
Sequence:CCGGCCATTCAAATATGAGAACTGTCTCGAGACAGTTCTCATATTTGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013359.1-1875s1c1
Sequence:CCGGCTCAGAGTACACAACTTCATTCTCGAGAATGAAGTTGTGTACTCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013359.1-834s1c1
Sequence:CCGGCTTACCGTTGTAATGAATGTACTCGAGTACATTCATTACAACGGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013359.1-2152s1c1
Sequence:CCGGAGTAAGTCTATGTGGGAGAAACTCGAGTTTCTCCCACATAGACTTACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013359.1-1688s1c1
Sequence:CCGGGAGTGTGGTAAGGACTATAAACTCGAGTTTATAGTCCTTACCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013359.2-1287s21c1
Sequence:CCGGGTGTTAGATCAAGACTTAATACTCGAGTATTAAGTCTTGATCTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013359.2-1876s21c1
Sequence:CCGGTCAGAGTTCACAACTTCATTCCTCGAGGAATGAAGTTGTGAACTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013359.2-1192s21c1
Sequence:CCGGGAAAGCCTTCATTCATGATTCCTCGAGGAATCATGAATGAAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013359
ZNF221 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 221
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013359.1-2258s1c1
Sequence:CCGGCCATTCAAATATGAGAACTGTCTCGAGACAGTTCTCATATTTGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013359.1-1875s1c1
Sequence:CCGGCTCAGAGTACACAACTTCATTCTCGAGAATGAAGTTGTGTACTCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013359.1-834s1c1
Sequence:CCGGCTTACCGTTGTAATGAATGTACTCGAGTACATTCATTACAACGGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013359.1-2152s1c1
Sequence:CCGGAGTAAGTCTATGTGGGAGAAACTCGAGTTTCTCCCACATAGACTTACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013359.1-1688s1c1
Sequence:CCGGGAGTGTGGTAAGGACTATAAACTCGAGTTTATAGTCCTTACCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013359.2-1287s21c1
Sequence:CCGGGTGTTAGATCAAGACTTAATACTCGAGTATTAAGTCTTGATCTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013359.2-1876s21c1
Sequence:CCGGTCAGAGTTCACAACTTCATTCCTCGAGGAATGAAGTTGTGAACTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013359.2-1192s21c1
Sequence:CCGGGAAAGCCTTCATTCATGATTCCTCGAGGAATCATGAATGAAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013359
ZNF221 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 221
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015268    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013359.1-2258s1c1
Sequence:CCGGCCATTCAAATATGAGAACTGTCTCGAGACAGTTCTCATATTTGAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013359.1-1875s1c1
Sequence:CCGGCTCAGAGTACACAACTTCATTCTCGAGAATGAAGTTGTGTACTCTGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013359.1-834s1c1
Sequence:CCGGCTTACCGTTGTAATGAATGTACTCGAGTACATTCATTACAACGGTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013359.1-2152s1c1
Sequence:CCGGAGTAAGTCTATGTGGGAGAAACTCGAGTTTCTCCCACATAGACTTACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013359.1-1688s1c1
Sequence:CCGGGAGTGTGGTAAGGACTATAAACTCGAGTTTATAGTCCTTACCACACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013359.2-1287s21c1
Sequence:CCGGGTGTTAGATCAAGACTTAATACTCGAGTATTAAGTCTTGATCTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416528    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013359.2-1876s21c1
Sequence:CCGGTCAGAGTTCACAACTTCATTCCTCGAGGAATGAAGTTGTGAACTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013359.2-1192s21c1
Sequence:CCGGGAAAGCCTTCATTCATGATTCCTCGAGGAATCATGAATGAAGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks