EMAIL THIS PAGE TO A FRIEND

ZNF222

zinc finger protein 222

Species: Human ZNF222(7673)
UniProtKB ID: Q9UK12, G5E9B9, Q8N6G7, Q9P1U5
Gene ID:
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013360 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013360 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020222 predicted 478
2 SASI_Hs01_00020223 predicted 432
3 SASI_Hs01_00020224 predicted 1257
4 SASI_Hs01_00020225 predicted 406
5 SASI_Hs01_00020226 predicted 367
6 SASI_Hs01_00020227 predicted 1030
7 SASI_Hs01_00020228 predicted 531
8 SASI_Hs01_00020229 predicted 1031
9 SASI_Hs01_00020230 predicted 535
10 SASI_Hs01_00020231 predicted 1369
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013360
ZNF222 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 222
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013360.2-1063s21c1
Sequence:CCGGTTCATTGATAGGCTAGATTTGCTCGAGCAAATCTAGCCTATCAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013360.2-689s21c1
Sequence:CCGGGAGTGAAATGCTATAAGTGTGCTCGAGCACACTTATAGCATTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013360.2-1395s21c1
Sequence:CCGGGAGGCTTGTATGCCGGTCATACTCGAGTATGACCGGCATACAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013360.1-464s1c1
Sequence:CCGGCCCAGATTAAAGCAAGACTATCTCGAGATAGTCTTGCTTTAATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013360.1-879s1c1
Sequence:CCGGGCACAATTTCCAGCTTCAGAACTCGAGTTCTGAAGCTGGAAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013360.1-406s1c1
Sequence:CCGGAGGTCTCAAGATACCACCATACTCGAGTATGGTGGTATCTTGAGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013360.1-1337s1c1
Sequence:CCGGGCCAAAGAAAGCCATTGAAATCTCGAGATTTCAATGGCTTTCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013360.1-1292s1c1
Sequence:CCGGGCTTTAGACATGCTTCTAGTACTCGAGTACTAGAAGCATGTCTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013360
ZNF222 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 222
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013360.2-1063s21c1
Sequence:CCGGTTCATTGATAGGCTAGATTTGCTCGAGCAAATCTAGCCTATCAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013360.2-689s21c1
Sequence:CCGGGAGTGAAATGCTATAAGTGTGCTCGAGCACACTTATAGCATTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013360.2-1395s21c1
Sequence:CCGGGAGGCTTGTATGCCGGTCATACTCGAGTATGACCGGCATACAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013360.1-464s1c1
Sequence:CCGGCCCAGATTAAAGCAAGACTATCTCGAGATAGTCTTGCTTTAATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013360.1-879s1c1
Sequence:CCGGGCACAATTTCCAGCTTCAGAACTCGAGTTCTGAAGCTGGAAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013360.1-406s1c1
Sequence:CCGGAGGTCTCAAGATACCACCATACTCGAGTATGGTGGTATCTTGAGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013360.1-1337s1c1
Sequence:CCGGGCCAAAGAAAGCCATTGAAATCTCGAGATTTCAATGGCTTTCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013360.1-1292s1c1
Sequence:CCGGGCTTTAGACATGCTTCTAGTACTCGAGTACTAGAAGCATGTCTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013360
ZNF222 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 222
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013360.2-1063s21c1
Sequence:CCGGTTCATTGATAGGCTAGATTTGCTCGAGCAAATCTAGCCTATCAATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013360.2-689s21c1
Sequence:CCGGGAGTGAAATGCTATAAGTGTGCTCGAGCACACTTATAGCATTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013360.2-1395s21c1
Sequence:CCGGGAGGCTTGTATGCCGGTCATACTCGAGTATGACCGGCATACAAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013360.1-464s1c1
Sequence:CCGGCCCAGATTAAAGCAAGACTATCTCGAGATAGTCTTGCTTTAATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013360.1-879s1c1
Sequence:CCGGGCACAATTTCCAGCTTCAGAACTCGAGTTCTGAAGCTGGAAATTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013360.1-406s1c1
Sequence:CCGGAGGTCTCAAGATACCACCATACTCGAGTATGGTGGTATCTTGAGACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013360.1-1337s1c1
Sequence:CCGGGCCAAAGAAAGCCATTGAAATCTCGAGATTTCAATGGCTTTCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013360.1-1292s1c1
Sequence:CCGGGCTTTAGACATGCTTCTAGTACTCGAGTACTAGAAGCATGTCTAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks