EMAIL THIS PAGE TO A FRIEND

ZNF223

zinc finger protein 223

Species: Human ZNF223(7766)
UniProtKB ID: Q9UK11, Q15736, Q8TBJ3, Q9HCA9
Gene ID:
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013361 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013361 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013361 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013361 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013361 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027011 predicted 693
2 SASI_Hs01_00027012 predicted 584
3 SASI_Hs01_00027013 predicted 601
4 SASI_Hs01_00027014 predicted 749
5 SASI_Hs01_00027015 predicted 1025
6 SASI_Hs01_00027016 predicted 1221
7 SASI_Hs01_00027017 predicted 1157
8 SASI_Hs01_00027018 predicted 590
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013361
ZNF223 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 223
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013361.2-1910s1c1
Sequence:CCGGCCTCTTATCTACCTGTACTTTCTCGAGAAAGTACAGGTAGATAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013361.2-721s1c1
Sequence:CCGGCTTCAGTGATATGTCCATCTTCTCGAGAAGATGGACATATCACTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013361.2-1123s1c1
Sequence:CCGGTGAGATATGTAGTGTGAGCTTCTCGAGAAGCTCACACTACATATCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013361.2-1224s1c1
Sequence:CCGGGCTTCATTCGTAGGCTGGATTCTCGAGAATCCAGCCTACGAATGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013361.2-592s1c1
Sequence:CCGGGCCTCAAGACTCTACCATAAACTCGAGTTTATGGTAGAGTCTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013361.4-1224s21c1
Sequence:CCGGGCTTCATTCGTAGGCTGGATTCTCGAGAATCCAGCCTACGAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013361.4-1784s21c1
Sequence:CCGGACATTTATCACCTCAATTATCCTCGAGGATAATTGAGGTGATAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013361.4-1697s21c1
Sequence:CCGGACGTAAGTGTTGTACATATTTCTCGAGAAATATGTACAACACTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013361.4-593s21c1
Sequence:CCGGCCTCAAGACTCTACCATAAAGCTCGAGCTTTATGGTAGAGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013361.4-695s21c1
Sequence:CCGGTCCAATTGTGGGAAGTGTAAACTCGAGTTTACACTTCCCACAATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013361
ZNF223 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 223
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013361.2-1910s1c1
Sequence:CCGGCCTCTTATCTACCTGTACTTTCTCGAGAAAGTACAGGTAGATAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013361.2-721s1c1
Sequence:CCGGCTTCAGTGATATGTCCATCTTCTCGAGAAGATGGACATATCACTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013361.2-1123s1c1
Sequence:CCGGTGAGATATGTAGTGTGAGCTTCTCGAGAAGCTCACACTACATATCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013361.2-1224s1c1
Sequence:CCGGGCTTCATTCGTAGGCTGGATTCTCGAGAATCCAGCCTACGAATGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013361.2-592s1c1
Sequence:CCGGGCCTCAAGACTCTACCATAAACTCGAGTTTATGGTAGAGTCTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013361.4-1224s21c1
Sequence:CCGGGCTTCATTCGTAGGCTGGATTCTCGAGAATCCAGCCTACGAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013361.4-1784s21c1
Sequence:CCGGACATTTATCACCTCAATTATCCTCGAGGATAATTGAGGTGATAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013361.4-1697s21c1
Sequence:CCGGACGTAAGTGTTGTACATATTTCTCGAGAAATATGTACAACACTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013361.4-593s21c1
Sequence:CCGGCCTCAAGACTCTACCATAAAGCTCGAGCTTTATGGTAGAGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013361.4-695s21c1
Sequence:CCGGTCCAATTGTGGGAAGTGTAAACTCGAGTTTACACTTCCCACAATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013361
ZNF223 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 223
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013063    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013361.2-1910s1c1
Sequence:CCGGCCTCTTATCTACCTGTACTTTCTCGAGAAAGTACAGGTAGATAAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013361.2-721s1c1
Sequence:CCGGCTTCAGTGATATGTCCATCTTCTCGAGAAGATGGACATATCACTGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013361.2-1123s1c1
Sequence:CCGGTGAGATATGTAGTGTGAGCTTCTCGAGAAGCTCACACTACATATCTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013361.2-1224s1c1
Sequence:CCGGGCTTCATTCGTAGGCTGGATTCTCGAGAATCCAGCCTACGAATGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013361.2-592s1c1
Sequence:CCGGGCCTCAAGACTCTACCATAAACTCGAGTTTATGGTAGAGTCTTGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013361.4-1224s21c1
Sequence:CCGGGCTTCATTCGTAGGCTGGATTCTCGAGAATCCAGCCTACGAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013361.4-1784s21c1
Sequence:CCGGACATTTATCACCTCAATTATCCTCGAGGATAATTGAGGTGATAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013361.4-1697s21c1
Sequence:CCGGACGTAAGTGTTGTACATATTTCTCGAGAAATATGTACAACACTTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013361.4-593s21c1
Sequence:CCGGCCTCAAGACTCTACCATAAAGCTCGAGCTTTATGGTAGAGTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013361.4-695s21c1
Sequence:CCGGTCCAATTGTGGGAAGTGTAAACTCGAGTTTACACTTCCCACAATTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks