EMAIL THIS PAGE TO A FRIEND

ZNF225

zinc finger protein 225

Species: Human ZNF225(7768)
UniProtKB ID: Q9UK10, A8K8S2, Q53F12, Q9NS46, Q9UID8
Gene ID:
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013362 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013362 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013362 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013362 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344694 predicted 651
2 SASI_Hs01_00135704 predicted 1811
3 SASI_Hs02_00344695 predicted 597
4 SASI_Hs01_00135706 predicted 739
5 SASI_Hs01_00135707 predicted 1727
6 SASI_Hs01_00135708 predicted 1295
7 SASI_Hs01_00135710 predicted 972
8 SASI_Hs01_00135712 predicted 1881
9 SASI_Hs01_00135713 predicted 840
10 SASI_Hs02_00344696 predicted 534
11 SASI_Hs01_00135705 predicted 1220
12 SASI_Hs01_00135709 predicted 389
13 SASI_Hs01_00135711 predicted 1139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013362
ZNF225 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 225
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013362.1-1304s1c1
Sequence:CCGGCGCTTCATTTATAGGCAAGATCTCGAGATCTTGCCTATAAATGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013362.1-536s1c1
Sequence:CCGGGAAGGCTTGTTCAGTCATCAACTCGAGTTGATGACTGAACAAGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013362.1-1141s1c1
Sequence:CCGGCCGTAGTAGAGCAAATCTTAACTCGAGTTAAGATTTGCTCTACTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013362.1-395s1c1
Sequence:CCGGCATCAATCACTCCACAGAGATCTCGAGATCTCTGTGGAGTGATTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013362.1-1740s1c1
Sequence:CCGGCACAACTTTATACCCATCGTACTCGAGTACGATGGGTATAAAGTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013362
ZNF225 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 225
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013362.1-1304s1c1
Sequence:CCGGCGCTTCATTTATAGGCAAGATCTCGAGATCTTGCCTATAAATGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013362.1-536s1c1
Sequence:CCGGGAAGGCTTGTTCAGTCATCAACTCGAGTTGATGACTGAACAAGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013362.1-1141s1c1
Sequence:CCGGCCGTAGTAGAGCAAATCTTAACTCGAGTTAAGATTTGCTCTACTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013362.1-395s1c1
Sequence:CCGGCATCAATCACTCCACAGAGATCTCGAGATCTCTGTGGAGTGATTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013362.1-1740s1c1
Sequence:CCGGCACAACTTTATACCCATCGTACTCGAGTACGATGGGTATAAAGTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013362
ZNF225 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 225
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013362.1-1304s1c1
Sequence:CCGGCGCTTCATTTATAGGCAAGATCTCGAGATCTTGCCTATAAATGAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013362.1-536s1c1
Sequence:CCGGGAAGGCTTGTTCAGTCATCAACTCGAGTTGATGACTGAACAAGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013362.1-1141s1c1
Sequence:CCGGCCGTAGTAGAGCAAATCTTAACTCGAGTTAAGATTTGCTCTACTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013362.1-395s1c1
Sequence:CCGGCATCAATCACTCCACAGAGATCTCGAGATCTCTGTGGAGTGATTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013362.1-1740s1c1
Sequence:CCGGCACAACTTTATACCCATCGTACTCGAGTACGATGGGTATAAAGTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks