EMAIL THIS PAGE TO A FRIEND

ZNF226

zinc finger protein 226

UniProtKB ID: Q9NYT6, Q8WWE6, Q96TE6, Q9NS44
Gene ID:
dog(100855887) zinc finger protein 226
domestic cat(101099258) zinc finger protein 226
naked mole-rat(101711059) zinc finger protein 226
cow(789006) zinc finger protein 226
sheep(101109731) zinc finger protein 226
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015919 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032372 Rosetta Predictions human pricing
NM_001032373 Rosetta Predictions human pricing
NM_001032374 Rosetta Predictions human pricing
NM_001032375 Rosetta Predictions human pricing
NM_015919 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032372 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039725 predicted 1798
2 SASI_Hs01_00039726 predicted 845
3 SASI_Hs01_00039727 predicted 333
4 SASI_Hs01_00039728 predicted 1726
5 SASI_Hs01_00039729 predicted 920
6 SASI_Hs02_00307908 predicted 2039
7 SASI_Hs02_00307909 predicted 2124
8 SASI_Hs01_00039730 predicted 1721
9 SASI_Hs01_00039731 predicted 1362
10 SASI_Hs01_00039732 predicted 355
11 SASI_Hs01_00039733 predicted 1457
12 SASI_Hs01_00039734 predicted 889
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032373 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092948 predicted 1756
2 SASI_Hs01_00092949 predicted 811
3 SASI_Hs01_00092950 predicted 298
4 SASI_Hs01_00092951 predicted 1685
5 SASI_Hs01_00092952 predicted 882
6 SASI_Hs02_00307910 predicted 2005
7 SASI_Hs02_00307911 predicted 2090
8 SASI_Hs01_00092953 predicted 1676
9 SASI_Hs01_00092954 predicted 1328
10 SASI_Hs01_00092955 predicted 323
11 SASI_Hs01_00092956 predicted 1428
12 SASI_Hs01_00092957 predicted 852
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032374 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307912 predicted 629
2 SASI_Hs01_00230362 predicted 469
3 SASI_Hs01_00230364 predicted 455
4 SASI_Hs02_00307913 predicted 653
5 SASI_Hs01_00230365 predicted 491
6 SASI_Hs02_00307914 predicted 767
7 SASI_Hs02_00307915 predicted 700
8 SASI_Hs02_00307916 predicted 720
9 SASI_Hs01_00230368 predicted 613
10 SASI_Hs01_00230369 predicted 588
11 SASI_Hs01_00230361 predicted 633
12 SASI_Hs01_00230363 predicted 949
13 SASI_Hs01_00230366 predicted 928
14 SASI_Hs01_00230367 predicted 632
15 SASI_Hs01_00230370 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032375 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307917 predicted 578
2 SASI_Hs01_00160163 predicted 426
3 SASI_Hs01_00160165 predicted 409
4 SASI_Hs02_00307918 predicted 604
5 SASI_Hs01_00160166 predicted 440
6 SASI_Hs02_00307919 predicted 721
7 SASI_Hs02_00307920 predicted 653
8 SASI_Hs02_00307921 predicted 681
9 SASI_Hs01_00160169 predicted 565
10 SASI_Hs01_00160170 predicted 538
11 SASI_Hs01_00160162 predicted 582
12 SASI_Hs01_00160164 predicted 913
13 SASI_Hs01_00160167 predicted 876
14 SASI_Hs01_00160168 predicted 578
15 SASI_Hs01_00160171 predicted 497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348535 predicted 460
2 SASI_Hs01_00229046 predicted 298
3 SASI_Hs02_00348536 predicted 776
4 SASI_Hs01_00229047 predicted 278
5 SASI_Hs02_00348537 predicted 662
6 SASI_Hs01_00229049 predicted 322
7 SASI_Hs01_00229054 predicted 442
8 SASI_Hs02_00348538 predicted 417
9 SASI_Hs02_00348539 predicted 369
10 SASI_Hs02_00348540 predicted 687
11 SASI_Hs01_00229045 predicted 462
12 SASI_Hs01_00229048 predicted 487
13 SASI_Hs01_00229050 predicted 604
14 SASI_Hs01_00229051 predicted 540
15 SASI_Hs01_00229052 predicted 555
16 SASI_Hs01_00229053 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015919
VALIDATED
ZNF226 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 226
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015919.2-439s1c1
Sequence:CCGGGAAGAAATGTTGGAAGTCATTCTCGAGAATGACTTCCAACATTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015919.2-284s1c1
Sequence:CCGGCCACCCTTCAAACAAGATGTACTCGAGTACATCTTGTTTGAAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_015919.2-348s1c1
Sequence:CCGGCAACCCGAAGACAGGGAAATTCTCGAGAATTTCCCTGTCTTCGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015919.2-329s1c1
Sequence:CCGGCTTTGGATAATGACGACAGCACTCGAGTGCTGTCGTCATTATCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_015919.2-359s1c1
Sequence:CCGGCAGGGAAATTTAGATACCTTACTCGAGTAAGGTATCTAAATTTCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015919.3-306s21c1
Sequence:CCGGAGATGTATCACCTATAGAAAGCTCGAGCTTTCTATAGGTGATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015919.3-329s21c1
Sequence:CCGGATGAGCAGCTTTGGATAATGACTCGAGTCATTATCCAAAGCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015919.3-409s21c1
Sequence:CCGGTATGACCTGGCTCAAACTTAACTCGAGTTAAGTTTGAGCCAGGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015919.3-481s21c1
Sequence:CCGGATGTTGGAAGGACTCATATATCTCGAGATATATGAGTCCTTCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015919.3-358s21c1
Sequence:CCGGACCCGAAGACAGGGAAATTTACTCGAGTAAATTTCCCTGTCTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015919
VALIDATED
ZNF226 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 226
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015919.2-439s1c1
Sequence:CCGGGAAGAAATGTTGGAAGTCATTCTCGAGAATGACTTCCAACATTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015919.2-284s1c1
Sequence:CCGGCCACCCTTCAAACAAGATGTACTCGAGTACATCTTGTTTGAAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_015919.2-348s1c1
Sequence:CCGGCAACCCGAAGACAGGGAAATTCTCGAGAATTTCCCTGTCTTCGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015919.2-329s1c1
Sequence:CCGGCTTTGGATAATGACGACAGCACTCGAGTGCTGTCGTCATTATCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_015919.2-359s1c1
Sequence:CCGGCAGGGAAATTTAGATACCTTACTCGAGTAAGGTATCTAAATTTCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015919.3-306s21c1
Sequence:CCGGAGATGTATCACCTATAGAAAGCTCGAGCTTTCTATAGGTGATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015919.3-329s21c1
Sequence:CCGGATGAGCAGCTTTGGATAATGACTCGAGTCATTATCCAAAGCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015919.3-409s21c1
Sequence:CCGGTATGACCTGGCTCAAACTTAACTCGAGTTAAGTTTGAGCCAGGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015919.3-481s21c1
Sequence:CCGGATGTTGGAAGGACTCATATATCTCGAGATATATGAGTCCTTCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015919.3-358s21c1
Sequence:CCGGACCCGAAGACAGGGAAATTTACTCGAGTAAATTTCCCTGTCTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015919
VALIDATED
ZNF226 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 226
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013078    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_015919.2-439s1c1
Sequence:CCGGGAAGAAATGTTGGAAGTCATTCTCGAGAATGACTTCCAACATTTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013081    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015919.2-284s1c1
Sequence:CCGGCCACCCTTCAAACAAGATGTACTCGAGTACATCTTGTTTGAAGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013079    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_015919.2-348s1c1
Sequence:CCGGCAACCCGAAGACAGGGAAATTCTCGAGAATTTCCCTGTCTTCGGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015919.2-329s1c1
Sequence:CCGGCTTTGGATAATGACGACAGCACTCGAGTGCTGTCGTCATTATCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_015919.2-359s1c1
Sequence:CCGGCAGGGAAATTTAGATACCTTACTCGAGTAAGGTATCTAAATTTCCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015919.3-306s21c1
Sequence:CCGGAGATGTATCACCTATAGAAAGCTCGAGCTTTCTATAGGTGATACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015919.3-329s21c1
Sequence:CCGGATGAGCAGCTTTGGATAATGACTCGAGTCATTATCCAAAGCTGCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015919.3-409s21c1
Sequence:CCGGTATGACCTGGCTCAAACTTAACTCGAGTTAAGTTTGAGCCAGGTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245100    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_015919.3-481s21c1
Sequence:CCGGATGTTGGAAGGACTCATATATCTCGAGATATATGAGTCCTTCCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015919.3-358s21c1
Sequence:CCGGACCCGAAGACAGGGAAATTTACTCGAGTAAATTTCCCTGTCTTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks