EMAIL THIS PAGE TO A FRIEND

ZNF227

zinc finger protein 227

UniProtKB ID: Q86WZ6, B3KRU7
Gene ID:
cow(524111) zinc finger protein 227
sheep(101109384) zinc finger protein 227
naked mole-rat(101709979) zinc finger protein 227
domestic cat(101099005) zinc finger protein 227
Horse(100070481) zinc finger protein 227
dog(484460) zinc finger protein 227
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182490 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182490 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182490 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120171 MISSION® esiRNA esiRNA human ZNF227 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182490 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182490 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032910 predicted 1962
2 SASI_Hs01_00032911 predicted 2627
3 SASI_Hs01_00032913 predicted 401
4 SASI_Hs02_00370528 predicted 1181
5 SASI_Hs01_00032914 predicted 1619
6 SASI_Hs01_00032915 predicted 2506
7 SASI_Hs01_00032916 predicted 1086
8 SASI_Hs01_00032917 predicted 2091
9 SASI_Hs02_00370529 predicted 1214
10 SASI_Hs01_00032918 predicted 2532
11 SASI_Hs01_00032909 predicted 618
12 SASI_Hs01_00032912 predicted 599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182490
ZNF227 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 227
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182490.1-838s21c1
Sequence:CCGGACCATTTCATGAGCATATTAACTCGAGTTAATATGCTCATGAAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182490.1-313s21c1
Sequence:CCGGACTGCGACTGCTCGATCTTACCTCGAGGTAAGATCGAGCAGTCGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182490.1-2815s21c1
Sequence:CCGGCTCTTGGTAAGATCTAGTTAACTCGAGTTAACTAGATCTTACCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182490.1-2867s1c1
Sequence:CCGGGCCTGAAGATAATGTGTGGAACTCGAGTTCCACACATTATCTTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182490.1-1626s1c1
Sequence:CCGGCCCGTAATACAGATCTGCATACTCGAGTATGCAGATCTGTATTACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182490.1-1010s1c1
Sequence:CCGGCCGAATGTTCACACAGGAGAACTCGAGTTCTCCTGTGTGAACATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182490.1-1212s1c1
Sequence:CCGGGCACGGGTCTTATCATTCATTCTCGAGAATGAATGATAAGACCCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182490.1-2561s1c1
Sequence:CCGGCGTCTTACATATCATCAGAAACTCGAGTTTCTGATGATATGTAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182490
ZNF227 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 227
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182490.1-838s21c1
Sequence:CCGGACCATTTCATGAGCATATTAACTCGAGTTAATATGCTCATGAAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182490.1-313s21c1
Sequence:CCGGACTGCGACTGCTCGATCTTACCTCGAGGTAAGATCGAGCAGTCGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182490.1-2815s21c1
Sequence:CCGGCTCTTGGTAAGATCTAGTTAACTCGAGTTAACTAGATCTTACCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182490.1-2867s1c1
Sequence:CCGGGCCTGAAGATAATGTGTGGAACTCGAGTTCCACACATTATCTTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182490.1-1626s1c1
Sequence:CCGGCCCGTAATACAGATCTGCATACTCGAGTATGCAGATCTGTATTACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182490.1-1010s1c1
Sequence:CCGGCCGAATGTTCACACAGGAGAACTCGAGTTCTCCTGTGTGAACATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182490.1-1212s1c1
Sequence:CCGGGCACGGGTCTTATCATTCATTCTCGAGAATGAATGATAAGACCCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182490.1-2561s1c1
Sequence:CCGGCGTCTTACATATCATCAGAAACTCGAGTTTCTGATGATATGTAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182490
ZNF227 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 227
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182490.1-838s21c1
Sequence:CCGGACCATTTCATGAGCATATTAACTCGAGTTAATATGCTCATGAAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182490.1-313s21c1
Sequence:CCGGACTGCGACTGCTCGATCTTACCTCGAGGTAAGATCGAGCAGTCGCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416172    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182490.1-2815s21c1
Sequence:CCGGCTCTTGGTAAGATCTAGTTAACTCGAGTTAACTAGATCTTACCAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182490.1-2867s1c1
Sequence:CCGGGCCTGAAGATAATGTGTGGAACTCGAGTTCCACACATTATCTTCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182490.1-1626s1c1
Sequence:CCGGCCCGTAATACAGATCTGCATACTCGAGTATGCAGATCTGTATTACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182490.1-1010s1c1
Sequence:CCGGCCGAATGTTCACACAGGAGAACTCGAGTTCTCCTGTGTGAACATTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182490.1-1212s1c1
Sequence:CCGGGCACGGGTCTTATCATTCATTCTCGAGAATGAATGATAAGACCCGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182490.1-2561s1c1
Sequence:CCGGCGTCTTACATATCATCAGAAACTCGAGTTTCTGATGATATGTAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks