EMAIL THIS PAGE TO A FRIEND

ZNF229

zinc finger protein 229

UniProtKB ID: Q9UJW7, B2RWN3, Q59FV2, Q86WL9
Gene ID:
dog(100687726) zinc finger protein 229
Horse(100070548) zinc finger protein 229
domestic cat(101097771) zinc finger protein 229
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014518 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014518 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014518 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004111 MISSION® esiRNA esiRNA targeting human ZNF229 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014518 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014518 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00345795 predicted 2884
2 SASI_Hs02_00345796 predicted 1470
3 SASI_Hs01_00078920 predicted 2984
4 SASI_Hs01_00078923 predicted 2671
5 SASI_Hs02_00345797 predicted 2505
6 SASI_Hs02_00345798 predicted 1918
7 SASI_Hs02_00345799 predicted 1022
8 SASI_Hs02_00345800 predicted 886
9 SASI_Hs02_00345801 predicted 1504
10 SASI_Hs01_00078928 predicted 2893
11 SASI_Hs01_00078921 predicted 810
12 SASI_Hs01_00078922 predicted 843
13 SASI_Hs01_00078924 predicted 874
14 SASI_Hs01_00078925 predicted 379
15 SASI_Hs01_00078926 predicted 571
16 SASI_Hs01_00078927 predicted 647
17 SASI_Hs01_00078929 predicted 211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014518
ZNF229 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 229
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014518.1-166s1c1
Sequence:CCGGGCTCAGGTCTCCTTAGTCATACTCGAGTATGACTAAGGAGACCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014518.1-429s1c1
Sequence:CCGGCGGAACCACCAAAGAGTGCATCTCGAGATGCACTCTTTGGTGGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014518.1-122s1c1
Sequence:CCGGGAAACCCTACACTTGTTGTGACTCGAGTCACAACAAGTGTAGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014518.1-337s1c1
Sequence:CCGGCCTGTCTTCATGTTCATCAAACTCGAGTTTGATGAACATGAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014518.1-176s1c1
Sequence:CCGGCCTTAGTCATAAGAGAGTGCACTCGAGTGCACTCTCTTATGACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014518.2-3124s21c1
Sequence:CCGGTGCAGCGGAGTAGGCTTTAAACTCGAGTTTAAAGCCTACTCCGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014518.2-3155s21c1
Sequence:CCGGAGCAGTGGTTTCAGTAATAATCTCGAGATTATTACTGAAACCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014518.2-3234s21c1
Sequence:CCGGATGTTTCCAAGGTGCTAATTACTCGAGTAATTAGCACCTTGGAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014518.2-682s21c1
Sequence:CCGGATGGAAAGGATACGGAGTATACTCGAGTATACTCCGTATCCTTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014518
ZNF229 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 229
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014518.1-166s1c1
Sequence:CCGGGCTCAGGTCTCCTTAGTCATACTCGAGTATGACTAAGGAGACCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014518.1-429s1c1
Sequence:CCGGCGGAACCACCAAAGAGTGCATCTCGAGATGCACTCTTTGGTGGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014518.1-122s1c1
Sequence:CCGGGAAACCCTACACTTGTTGTGACTCGAGTCACAACAAGTGTAGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014518.1-337s1c1
Sequence:CCGGCCTGTCTTCATGTTCATCAAACTCGAGTTTGATGAACATGAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014518.1-176s1c1
Sequence:CCGGCCTTAGTCATAAGAGAGTGCACTCGAGTGCACTCTCTTATGACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014518.2-3124s21c1
Sequence:CCGGTGCAGCGGAGTAGGCTTTAAACTCGAGTTTAAAGCCTACTCCGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014518.2-3155s21c1
Sequence:CCGGAGCAGTGGTTTCAGTAATAATCTCGAGATTATTACTGAAACCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014518.2-3234s21c1
Sequence:CCGGATGTTTCCAAGGTGCTAATTACTCGAGTAATTAGCACCTTGGAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014518.2-682s21c1
Sequence:CCGGATGGAAAGGATACGGAGTATACTCGAGTATACTCCGTATCCTTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014518
ZNF229 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 229
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014518.1-166s1c1
Sequence:CCGGGCTCAGGTCTCCTTAGTCATACTCGAGTATGACTAAGGAGACCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014518.1-429s1c1
Sequence:CCGGCGGAACCACCAAAGAGTGCATCTCGAGATGCACTCTTTGGTGGTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014518.1-122s1c1
Sequence:CCGGGAAACCCTACACTTGTTGTGACTCGAGTCACAACAAGTGTAGGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014518.1-337s1c1
Sequence:CCGGCCTGTCTTCATGTTCATCAAACTCGAGTTTGATGAACATGAAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014518.1-176s1c1
Sequence:CCGGCCTTAGTCATAAGAGAGTGCACTCGAGTGCACTCTCTTATGACTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438085    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014518.2-3124s21c1
Sequence:CCGGTGCAGCGGAGTAGGCTTTAAACTCGAGTTTAAAGCCTACTCCGCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014518.2-3155s21c1
Sequence:CCGGAGCAGTGGTTTCAGTAATAATCTCGAGATTATTACTGAAACCACTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014518.2-3234s21c1
Sequence:CCGGATGTTTCCAAGGTGCTAATTACTCGAGTAATTAGCACCTTGGAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014518.2-682s21c1
Sequence:CCGGATGGAAAGGATACGGAGTATACTCGAGTATACTCCGTATCCTTTCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks