EMAIL THIS PAGE TO A FRIEND

ZNF22

zinc finger protein 22

Synonyms: HKR-T1 KOX15 ZNF422 Zfp422
UniProtKB ID: P17026, Q5T741, Q96FM4
Gene ID:
cow(768051) zinc finger protein 22 (KOX 15)
sheep(101120381) zinc finger protein 22
naked mole-rat(101698278) zinc finger protein 22
domestic guinea pig(100735352) zinc finger protein 22
domestic cat(101098491) zinc finger protein 22
21 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006963 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006963 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006963 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU130021 MISSION® esiRNA esiRNA human ZNF22 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006963 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006963 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245920 predicted 734
2 SASI_Hs01_00245921 predicted 705
3 SASI_Hs01_00245923 predicted 690
4 SASI_Hs01_00245925 predicted 643
5 SASI_Hs01_00245926 predicted 617
6 SASI_Hs01_00245927 predicted 862
7 SASI_Hs01_00245928 predicted 1017
8 SASI_Hs01_00245929 predicted 631
9 SASI_Hs01_00245924 predicted 1634
10 SASI_Hs02_00342703 predicted 1533
11 SASI_Hs01_00245922 predicted 882
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006963
VALIDATED
ZNF22 MISSION shRNA Bacterial Glycerol Stock
zinc finger protein 22
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006963.3-742s21c1
Sequence:CCGGTTGGATGACAAACCCTATAAACTCGAGTTTATAGGGTTTGTCATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006963.3-1199s21c1
Sequence:CCGGTCAGGGTGAAGACTCACTTACCTCGAGGTAAGTGAGTCTTCACCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006963.3-1989s21c1
Sequence:CCGGAGTCTTCTATTCCTACTAATACTCGAGTATTAGTAGGAATAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006963.3-1249s21c1
Sequence:CCGGTCTGTGGCTGGTCTCCGTTAACTCGAGTTAACGGAGACCAGCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006963.3-865s21c1
Sequence:CCGGAGTTTCTTTCAGAGTTCTAATCTCGAGATTAGAACTCTGAAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006963.2-690s1c1
Sequence:CCGGCACATGAAGGTGCATAAAGAACTCGAGTTCTTTATGCACCTTCATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_006963.2-286s1c1
Sequence:CCGGTGGATGACAAACCCTATAAATCTCGAGATTTATAGGGTTTGTCATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006963.2-182s1c1
Sequence:CCGGCCAAGGAAAGGCCTATGAGAACTCGAGTTCTCATAGGCCTTTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_006963.2-766s1c1
Sequence:CCGGCTTGGAAAGCTGGTACAGGAACTCGAGTTCCTGTACCAGCTTTCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006963
VALIDATED
ZNF22 MISSION shRNA shRNA Plasmid DNA
zinc finger protein 22
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006963.3-742s21c1
Sequence:CCGGTTGGATGACAAACCCTATAAACTCGAGTTTATAGGGTTTGTCATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006963.3-1199s21c1
Sequence:CCGGTCAGGGTGAAGACTCACTTACCTCGAGGTAAGTGAGTCTTCACCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006963.3-1989s21c1
Sequence:CCGGAGTCTTCTATTCCTACTAATACTCGAGTATTAGTAGGAATAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006963.3-1249s21c1
Sequence:CCGGTCTGTGGCTGGTCTCCGTTAACTCGAGTTAACGGAGACCAGCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006963.3-865s21c1
Sequence:CCGGAGTTTCTTTCAGAGTTCTAATCTCGAGATTAGAACTCTGAAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006963.2-690s1c1
Sequence:CCGGCACATGAAGGTGCATAAAGAACTCGAGTTCTTTATGCACCTTCATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_006963.2-286s1c1
Sequence:CCGGTGGATGACAAACCCTATAAATCTCGAGATTTATAGGGTTTGTCATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006963.2-182s1c1
Sequence:CCGGCCAAGGAAAGGCCTATGAGAACTCGAGTTCTCATAGGCCTTTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_006963.2-766s1c1
Sequence:CCGGCTTGGAAAGCTGGTACAGGAACTCGAGTTCCTGTACCAGCTTTCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006963
VALIDATED
ZNF22 MISSION shRNA Lentiviral Transduction Particles
zinc finger protein 22
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006963.3-742s21c1
Sequence:CCGGTTGGATGACAAACCCTATAAACTCGAGTTTATAGGGTTTGTCATCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006963.3-1199s21c1
Sequence:CCGGTCAGGGTGAAGACTCACTTACCTCGAGGTAAGTGAGTCTTCACCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234620    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006963.3-1989s21c1
Sequence:CCGGAGTCTTCTATTCCTACTAATACTCGAGTATTAGTAGGAATAGAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006963.3-1249s21c1
Sequence:CCGGTCTGTGGCTGGTCTCCGTTAACTCGAGTTAACGGAGACCAGCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006963.3-865s21c1
Sequence:CCGGAGTTTCTTTCAGAGTTCTAATCTCGAGATTAGAACTCTGAAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006963.2-690s1c1
Sequence:CCGGCACATGAAGGTGCATAAAGAACTCGAGTTCTTTATGCACCTTCATGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_006963.2-286s1c1
Sequence:CCGGTGGATGACAAACCCTATAAATCTCGAGATTTATAGGGTTTGTCATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006963.2-182s1c1
Sequence:CCGGCCAAGGAAAGGCCTATGAGAACTCGAGTTCTCATAGGCCTTTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_006963.2-766s1c1
Sequence:CCGGCTTGGAAAGCTGGTACAGGAACTCGAGTTCCTGTACCAGCTTTCCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks